RchiOBHm_Chr6g0255091

Transmembrane protein 230-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Reverse (-)
10339171 .. 10339523
353 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGATGGAGACGTCTTACCCCCTCAACAACAAGCCTCCAATCAAAGAGATAGCTCTCGACATCGCCCTTCTCGTCATCGGAACCCTCGACATTATCGTCGACACCCTCATGGCCTATAACCCCGTCGGCGTGTACTTATTTGCGATTCTTGGTGGGATCTTGTTCATTCCAGGCTCCTATTACACACGGATTGCTTATTATGCTTACAAAGGATACAAGTGCTTCTCTTTCTCCAATATACCGCCTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF872

Protein Analysis

83

Amino Acids

9.29

Weight (kDa)

6.0

Isoelectric Point (pI)

26.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMEM_230_134 PF05915 13 - 81 7.4e-12 Transmembrane proteins 230/134
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 95
AatII GACGTC 1 cut(s) 14
AccI GTMKAC 1 cut(s) 99
AciI CCGC 1 cut(s) 242
AclWI GGATC 1 cut(s) 164
AcyI GRCGYC 1 cut(s) 11
AfaI GTAC 1 cut(s) 134
AjnI CCWGG 1 cut(s) 169
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Alw26I GTCTC 1 cut(s) 2
AlwI GGATC 1 cut(s) 164
AoxI GGCC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 171
BciVI GTATCC 1 cut(s) 206
BcoDI GTCTC 1 cut(s) 2
BfuI GTATCC 1 cut(s) 206
Bme1390I CCNGG 1 cut(s) 171
BmiI GGNNCC 2 cut(s) 82, 175
BmrFI CCNGG 1 cut(s) 171
BsaHI GRCGYC 1 cut(s) 11
BseBI CCWGG 1 cut(s) 171
BshFI GGCC 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 2
BsmBI CGTCTC 1 cut(s) 2
BsnI GGCC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 156
BspACI CCGC 1 cut(s) 242
BspANI GGCC 1 cut(s) 113
BspLI GGNNCC 2 cut(s) 82, 175
BspPI GGATC 1 cut(s) 164
BssMI GATC 1 cut(s) 156
BssNI GRCGYC 1 cut(s) 11
Bst2UI CCWGG 1 cut(s) 171
BstACI GRCGYC 1 cut(s) 11
BstKTI GATC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 2
BstMBI GATC 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstNI CCWGG 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 169
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
BsuI GTATCC 1 cut(s) 206
BsuRI GGCC 1 cut(s) 113
BtgZI GCGATG 1 cut(s) 46
Csp6I GTAC 1 cut(s) 133
CviAII CATG 1 cut(s) 109
CviJI RGCY 4 cut(s) 34, 53, 113, 174
CviKI_1 RGCY 4 cut(s) 34, 53, 113, 174
CviQI GTAC 1 cut(s) 133
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
DrdI GACNNNNNNGTC 1 cut(s) 95
DseDI GACNNNNNNGTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 169
Esp3I CGTCTC 1 cut(s) 2
FaeI CATG 1 cut(s) 112
FaiI YATR 5 cut(s) 110, 117, 201, 239, 248
FatI CATG 1 cut(s) 108
FblI GTMKAC 1 cut(s) 99
HaeIII GGCC 1 cut(s) 113
Hin1I GRCGYC 1 cut(s) 11
Hin1II CATG 1 cut(s) 112
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 2 cut(s) 100, 133
Hpy188I TCNGA 1 cut(s) 80
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 2 cut(s) 100, 133
Hpy99I CGWCG 2 cut(s) 101, 128
HpyAV CCTTC 1 cut(s) 77
HpyCH4IV ACGT 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 11
Hsp92I GRCGYC 1 cut(s) 11
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 156
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 2 cut(s) 156, 183
MaeII ACGT 1 cut(s) 11
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MflI RGATCY 1 cut(s) 156
MnlI CCTC 4 cut(s) 32, 45, 95, 116
MslI CAYNNNNRTG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 200
NdeII GATC 1 cut(s) 156
NlaIII CATG 1 cut(s) 112
NlaIV GGNNCC 2 cut(s) 82, 175
PcsI WCGNNNNNNNCGW 3 cut(s) 69, 84, 93
PfeI GAWTC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 169
PspGI CCWGG 1 cut(s) 169
PspN4I GGNNCC 2 cut(s) 82, 175
PsuI RGATCY 1 cut(s) 156
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
RseI CAYNNNNRTG 1 cut(s) 107
SalI GTCGAC 1 cut(s) 98
Sau3AI GATC 1 cut(s) 156
ScrFI CCNGG 1 cut(s) 171
SetI ASST 2 cut(s) 14, 55
SmiMI CAYNNNNRTG 1 cut(s) 107
SsiI CCGC 1 cut(s) 242
StyD4I CCNGG 1 cut(s) 169
TaiI ACGT 1 cut(s) 14
TaqI TCGA 3 cut(s) 57, 87, 99
TatI WGTACW 1 cut(s) 132
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 154
TspGWI ACGGA 1 cut(s) 202
XmiI GTMKAC 1 cut(s) 99
ZraI GACGTC 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.