RchiOBHm_Chr6g0275251

peroxiredoxin activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Forward (+)
36943751 .. 36943975
225 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGCAAACGGTCAACATTCACTCCATCACCGCTGGCCAGAAGATCGTCGGAGTCCCCAATGCCTTCAACCACACTTTCAGTTTGAAGCATGTTCCTAGATATATTGAGAATACATATGAGCTTAAATCGAAGGGTGTTGACAAAATTCTCTGCCTCGGTGTGAATAACCCCTTTGTGATGAAGGCATGGGCCAAATCCTACTCTGAGCTTCTTTTTCGGTGCTAA

Protein Analysis

74

Amino Acids

8.4

Weight (kDa)

9.51

Isoelectric Point (pI)

20.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Redoxin PF08534 2 - 65 3.3e-09 Redoxin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 30
AcoI YGGCCR 1 cut(s) 34
AcsI RAATTY 1 cut(s) 144
AgsI TTSAA 2 cut(s) 67, 85
AluBI AGCT 2 cut(s) 121, 208
AluI AGCT 2 cut(s) 121, 208
AoxI GGCC 2 cut(s) 34, 189
ApoI RAATTY 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 19
BalI TGGCCA 1 cut(s) 36
BccI CCATC 1 cut(s) 32
BfaI CTAG 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 154
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
BseDI CCNNGG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 195
BshFI GGCC 2 cut(s) 36, 191
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
BsnI GGCC 2 cut(s) 36, 191
Bsp143I GATC 1 cut(s) 42
BspACI CCGC 1 cut(s) 30
BspANI GGCC 2 cut(s) 36, 191
BspCNI CTCAG 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 204
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 92
BsuRI GGCC 2 cut(s) 36, 191
Cac8I GCNNGC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 189
CviAII CATG 2 cut(s) 89, 186
CviJI RGCY 4 cut(s) 36, 121, 191, 208
CviKI_1 RGCY 4 cut(s) 36, 121, 191, 208
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
EaeI YGGCCR 1 cut(s) 34
FaeI CATG 2 cut(s) 92, 189
FaiI YATR 5 cut(s) 90, 102, 115, 117, 187
FaqI GGGAC 1 cut(s) 38
FatI CATG 2 cut(s) 88, 185
FauNDI CATATG 1 cut(s) 115
FspBI CTAG 1 cut(s) 96
HaeIII GGCC 2 cut(s) 36, 191
Hin1II CATG 2 cut(s) 92, 189
HincII GTYRAC 2 cut(s) 13, 139
HindII GTYRAC 2 cut(s) 13, 139
HinfI GANTC 1 cut(s) 51
HphI GGTGA 1 cut(s) 19
Hpy166II GTNNAC 2 cut(s) 13, 139
Hpy188I TCNGA 2 cut(s) 50, 205
Hpy8I GTNNAC 2 cut(s) 13, 139
Hpy99I CGWCG 1 cut(s) 50
HpyAV CCTTC 3 cut(s) 73, 124, 175
HpyCH4III ACNGT 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 2 cut(s) 92, 189
Kzo9I GATC 1 cut(s) 42
LpnPI CCDG 2 cut(s) 18, 50
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MboII GAAGA 1 cut(s) 52
MlsI TGGCCA 1 cut(s) 36
MluCI AATT 1 cut(s) 144
MluNI TGGCCA 1 cut(s) 36
MlyI GAGTC 1 cut(s) 60
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 1 cut(s) 164
Mox20I TGGCCA 1 cut(s) 36
MscI TGGCCA 1 cut(s) 36
MseI TTAA 1 cut(s) 123
Msp20I TGGCCA 1 cut(s) 36
MspA1I CMGCKG 1 cut(s) 32
NdeI CATATG 1 cut(s) 115
NdeII GATC 1 cut(s) 42
NlaIII CATG 2 cut(s) 92, 189
NspI RCATGY 1 cut(s) 92
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 189
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 189
SchI GAGTC 1 cut(s) 60
SetI ASST 2 cut(s) 123, 210
SgeI CNNG 6 cut(s) 45, 49, 101, 108, 167, 198
Sse9I AATT 1 cut(s) 144
SsiI CCGC 1 cut(s) 30
SspMI CTAG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 10
TaqI TCGA 1 cut(s) 128
TasI AATT 1 cut(s) 144
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 194
XapI RAATTY 1 cut(s) 144
XceI RCATGY 1 cut(s) 92
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.