RchiOBHm_Chr6g0291541

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0030351
Physical Location & Seq
Forward (+)
54647040 .. 54647479
440 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 366 bp
ATGGACTCGATTTTAAACTCATCCTTGCAAGAAATCTGCTCGGAAGGTCCAAACGGTCTCCCTCTTCAAACCCTCTCCTCCAGGCTCAACCTCTCTCCGCCACTCCAACAACCCCTATGGGCGGCGCTACTCTCCGTCCCCGCCCTCAAATTCCACGCCCAAACCCAAAACGCCACCGTTTCGCACCTCCCCACAGACCCTTCAATCCAGTCGTTCCGCGACGCCGAGAAGCTCAACCTGAAGCTCGTCGCCGACCAGCCTCTCCGCAACAACTTCCTCGGCCTCTACGACGTCCAGTCCGCATCCGACACCATGTGCGAGTACCAACGCAAAACCCTAGAGCGCGTGGCCGCGGCTGGGTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B-block_TFIIIC

Protein Analysis

121

Amino Acids

13.23

Weight (kDa)

5.54

Isoelectric Point (pI)

53.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_GTF3C1_N PF23704 1 - 96 5.2e-27 General transcription factor 3C polypeptide 1, winged-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030351)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0291541
rosa_samantha Rh6CG345500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 294
AccII CGCG 3 cut(s) 219, 345, 353
AciI CCGC 8 cut(s) 98, 122, 141, 217, 265, 300, 351, 353
AcoI YGGCCR 1 cut(s) 348
AcsI RAATTY 1 cut(s) 149
AcuI CTGAAG 1 cut(s) 260
AcyI GRCGYC 2 cut(s) 222, 291
AdeI CACNNNGTG 1 cut(s) 315
AfaI GTAC 1 cut(s) 323
AfiI CCNNNNNNNGG 2 cut(s) 121, 357
AgsI TTSAA 2 cut(s) 68, 204
AhdI GACNNNNNGTC 1 cut(s) 295
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 2 cut(s) 232, 244
AluI AGCT 2 cut(s) 232, 244
Alw26I GTCTC 1 cut(s) 62
AoxI GGCC 2 cut(s) 280, 348
ApoI RAATTY 1 cut(s) 149
AspLEI GCGC 2 cut(s) 127, 345
AspS9I GGNCC 1 cut(s) 47
AvaII GGWCC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 338
BfoI RGCGCY 1 cut(s) 128
BisI GCNGC 3 cut(s) 123, 351, 354
BlsI GCNGC 3 cut(s) 124, 352, 355
Bme1390I CCNGG 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 47
BmeRI GACNNNNNGTC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 47
BmrFI CCNGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 311
BpmI CTGGAG 1 cut(s) 64
BsaHI GRCGYC 2 cut(s) 222, 291
BsaI GGTCTC 1 cut(s) 62
BsaJI CCNNGG 2 cut(s) 277, 351
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 357
Bse1I ACTGG 2 cut(s) 208, 295
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 2 cut(s) 277, 351
BseGI GGATG 2 cut(s) 20, 302
BseLI CCNNNNNNNGG 2 cut(s) 121, 357
BseNI ACTGG 2 cut(s) 208, 295
BseRI GAGGAG 1 cut(s) 67
BseYI CCCAGC 1 cut(s) 356
Bsh1236I CGCG 3 cut(s) 219, 345, 353
BshFI GGCC 2 cut(s) 282, 350
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 2 cut(s) 121, 357
BsmAI GTCTC 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 122
BsnI GGCC 2 cut(s) 282, 350
Bso31I GGTCTC 1 cut(s) 62
BspACI CCGC 8 cut(s) 98, 122, 141, 217, 265, 300, 351, 353
BspANI GGCC 2 cut(s) 282, 350
BspFNI CGCG 3 cut(s) 219, 345, 353
BspTNI GGTCTC 1 cut(s) 62
BsrI ACTGG 2 cut(s) 208, 295
BssECI CCNNGG 2 cut(s) 277, 351
BssNI GRCGYC 2 cut(s) 222, 291
Bst2UI CCWGG 1 cut(s) 82
Bst4CI ACNGT 2 cut(s) 56, 178
Bst6I CTCTTC 1 cut(s) 69
BstACI GRCGYC 2 cut(s) 222, 291
BstDSI CCRYGG 1 cut(s) 351
BstF5I GGATG 2 cut(s) 20, 302
BstFNI CGCG 3 cut(s) 219, 345, 353
BstH2I RGCGCY 1 cut(s) 128
BstHHI GCGC 2 cut(s) 127, 345
BstMAI GTCTC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
BstUI CGCG 3 cut(s) 219, 345, 353
BsuRI GGCC 2 cut(s) 282, 350
BtgI CCRYGG 1 cut(s) 351
BtsCI GGATG 2 cut(s) 20, 302
CfoI GCGC 2 cut(s) 127, 345
Cfr13I GGNCC 1 cut(s) 47
Cfr42I CCGCGG 1 cut(s) 354
CseI GACGC 1 cut(s) 230
Csp6I GTAC 1 cut(s) 322
CviAII CATG 1 cut(s) 313
CviJI RGCY 7 cut(s) 85, 232, 244, 259, 282, 350, 356
CviKI_1 RGCY 7 cut(s) 85, 232, 244, 259, 282, 350, 356
CviQI GTAC 1 cut(s) 322
DraI TTTAAA 1 cut(s) 15
DraIII CACNNNGTG 1 cut(s) 315
DriI GACNNNNNGTC 1 cut(s) 295
EaeI YGGCCR 1 cut(s) 348
Eam1104I CTCTTC 1 cut(s) 69
Eam1105I GACNNNNNGTC 1 cut(s) 295
EarI CTCTTC 1 cut(s) 69
EciI GGCGGA 1 cut(s) 87
Eco31I GGTCTC 1 cut(s) 62
Eco47I GGWCC 1 cut(s) 47
Eco57I CTGAAG 1 cut(s) 260
EcoRII CCWGG 1 cut(s) 80
FaeI CATG 1 cut(s) 316
FaiI YATR 3 cut(s) 118, 314, 364
FaqI GGGAC 1 cut(s) 122
FatI CATG 1 cut(s) 312
FauI CCCGC 1 cut(s) 148
Fnu4HI GCNGC 3 cut(s) 123, 351, 354
FokI GGATG 2 cut(s) 7, 289
Fsp4HI GCNGC 3 cut(s) 123, 351, 354
FspBI CTAG 1 cut(s) 338
GlaI GCGC 2 cut(s) 126, 344
GluI GCNGC 3 cut(s) 123, 351, 354
GsaI CCCAGC 1 cut(s) 360
GsuI CTGGAG 1 cut(s) 64
HaeII RGCGCY 1 cut(s) 128
HaeIII GGCC 2 cut(s) 282, 350
HgaI GACGC 1 cut(s) 230
HhaI GCGC 2 cut(s) 127, 345
Hin1I GRCGYC 2 cut(s) 222, 291
Hin1II CATG 1 cut(s) 316
Hin6I GCGC 2 cut(s) 125, 343
HinP1I GCGC 2 cut(s) 125, 343
HinfI GANTC 1 cut(s) 5
Hpy188I TCNGA 2 cut(s) 43, 307
Hpy99I CGWCG 3 cut(s) 224, 251, 293
HpyAV CCTTC 2 cut(s) 38, 210
HpyCH4III ACNGT 2 cut(s) 56, 178
HpyCH4IV ACGT 1 cut(s) 291
HpyCH4V TGCA 1 cut(s) 28
HpySE526I ACGT 1 cut(s) 291
Hsp92I GRCGYC 2 cut(s) 222, 291
Hsp92II CATG 1 cut(s) 316
HspAI GCGC 2 cut(s) 125, 343
KspI CCGCGG 1 cut(s) 354
LpnPI CCDG 7 cut(s) 67, 94, 221, 251, 269, 308, 342
LweI GCATC 1 cut(s) 311
MaeI CTAG 1 cut(s) 338
MaeII ACGT 1 cut(s) 291
MboII GAAGA 1 cut(s) 56
MluCI AATT 1 cut(s) 149
MmeI TCCRAC 2 cut(s) 130, 330
MnlI CCTC 9 cut(s) 72, 83, 88, 101, 155, 197, 270, 287, 293
MseI TTAA 1 cut(s) 14
MspA1I CMGCKG 1 cut(s) 353
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
MvnI CGCG 3 cut(s) 219, 345, 353
NlaIII CATG 1 cut(s) 316
NmeAIII GCCGAG 2 cut(s) 250, 258
PcsI WCGNNNNNNNCGW 1 cut(s) 285
PkrI GCNGC 3 cut(s) 124, 352, 355
Psp6I CCWGG 1 cut(s) 80
PspFI CCCAGC 1 cut(s) 356
PspGI CCWGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 47
RsaI GTAC 1 cut(s) 323
RsaNI GTAC 1 cut(s) 322
SacII CCGCGG 1 cut(s) 354
SaqAI TTAA 1 cut(s) 14
SatI GCNGC 3 cut(s) 123, 351, 354
Sau96I GGNCC 1 cut(s) 47
ScrFI CCNGG 1 cut(s) 82
SetI ASST 7 cut(s) 49, 93, 189, 234, 240, 246, 294
SfaNI GCATC 1 cut(s) 311
Sfr303I CCGCGG 1 cut(s) 354
SgrBI CCGCGG 1 cut(s) 354
SinI GGWCC 1 cut(s) 47
Sse9I AATT 1 cut(s) 149
SsiI CCGC 8 cut(s) 98, 122, 141, 217, 265, 300, 351, 353
SspMI CTAG 1 cut(s) 338
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 2 cut(s) 56, 178
TaiI ACGT 1 cut(s) 294
TaqI TCGA 1 cut(s) 8
TasI AATT 1 cut(s) 149
TauI GCSGC 3 cut(s) 125, 353, 356
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TspGWI ACGGA 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 47
XapI RAATTY 1 cut(s) 149
XspI CTAG 1 cut(s) 338
ZraI GACGTC 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.