RchiOBHm_Chr6g0291891

ER lumen

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Forward (+)
54949073 .. 54951143
2071 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 492 bp
ATGGCTTGGCTTGGACTCTCCCTCAAGTCACTGGAACTAACGGCTCTGTATCTGGGAATTAAGGTGTATTGCAGTGTGCTCATGACAGATGAGTGGTGGGTCCTGTTCTTACATGAGGTGCCTATTCTGATGGCAACGCTGTGGATTATCTATATGATTCGGTTCGAAGTCAGGTCCAGCTATATGGAGGGCAAAGACAACTTCCCAATCTGTGGTGCCATGTCTTCTGCTATCTGTAGCCATTCCCCTATCCACAGAGCACTTCATTTTGAACAGAATTTTGTGGGCTTTCTACGAAAAGTTTATCTTAAAGCTGTGTCAGCATTACCTCAGCTATGGATTATACATAATACAAAGATTGTGGAACCATACAAGGCGTATAATGTTGTTTCACTTGGAATTGCACCTTTCATCATTATTGCAAATTGTGTCAACCAGGTTTTGATGCCTAGAGGTGACTTGGCATGGGGAACGATTTGTGGCCCACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05110 map05110
Pfam Domains
Protein Families
ER_lumen_recept

Protein Analysis

163

Amino Acids

18.51

Weight (kDa)

8.29

Isoelectric Point (pI)

32.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER_lumen_recept PF00810 5 - 143 7.4e-17 ER lumen protein retaining receptor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 118, 215
AccB7I CCANNNNNTGG 1 cut(s) 212
AcsI RAATTY 1 cut(s) 277
AfiI CCNNNNNNNGG 1 cut(s) 212
AgsI TTSAA 1 cut(s) 272
AjnI CCWGG 1 cut(s) 435
AluBI AGCT 3 cut(s) 180, 314, 334
AluI AGCT 3 cut(s) 180, 314, 334
Alw21I GWGCWC 2 cut(s) 81, 262
AoxI GGCC 1 cut(s) 481
ApoI RAATTY 1 cut(s) 277
AspS9I GGNCC 3 cut(s) 100, 174, 482
AsuHPI GGTGA 1 cut(s) 467
AsuII TTCGAA 1 cut(s) 165
AvaII GGWCC 2 cut(s) 100, 174
BanI GGYRCC 2 cut(s) 118, 215
BbsI GAAGAC 1 cut(s) 216
Bbv12I GWGCWC 2 cut(s) 81, 262
BbvCI CCTCAGC 1 cut(s) 330
BccI CCATC 1 cut(s) 124
BceAI ACGGC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 437
BfaI CTAG 1 cut(s) 450
BfmI CTRYAG 1 cut(s) 235
Bme1390I CCNGG 1 cut(s) 437
Bme18I GGWCC 2 cut(s) 100, 174
BmgT120I GGNCC 3 cut(s) 100, 174, 482
BmiI GGNNCC 4 cut(s) 101, 120, 217, 366
BmrFI CCNGG 1 cut(s) 437
BmsI GCATC 1 cut(s) 435
BpiI GAAGAC 1 cut(s) 216
Bpu10I CCTNAGC 1 cut(s) 330
Bpu14I TTCGAA 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 212
Bse1I ACTGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 437
BseLI CCNNNNNNNGG 1 cut(s) 212
BseMII CTCAG 1 cut(s) 344
BseNI ACTGG 1 cut(s) 36
BshFI GGCC 1 cut(s) 483
BshNI GGYRCC 2 cut(s) 118, 215
BsiHKAI GWGCWC 2 cut(s) 81, 262
BslI CCNNNNNNNGG 1 cut(s) 212
BsnI GGCC 1 cut(s) 483
Bsp119I TTCGAA 1 cut(s) 165
Bsp1286I GDGCHC 2 cut(s) 81, 262
BspANI GGCC 1 cut(s) 483
BspCNI CTCAG 1 cut(s) 343
BspHI TCATGA 1 cut(s) 81
BspLI GGNNCC 4 cut(s) 101, 120, 217, 366
BspT104I TTCGAA 1 cut(s) 165
BspT107I GGYRCC 2 cut(s) 118, 215
BsrI ACTGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 437
BstBI TTCGAA 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 330
BstMWI GCNNNNNNNGC 1 cut(s) 320
BstNI CCWGG 1 cut(s) 437
BstSCI CCNGG 1 cut(s) 435
BstSFI CTRYAG 1 cut(s) 235
BstV2I GAAGAC 1 cut(s) 216
BstXI CCANNNNNNTGG 1 cut(s) 184
BsuRI GGCC 1 cut(s) 483
BtsI GCAGTG 1 cut(s) 79
BtsIMutI CAGTG 2 cut(s) 29, 79
CciI TCATGA 1 cut(s) 81
Cfr13I GGNCC 3 cut(s) 100, 174, 482
CsiI ACCWGGT 1 cut(s) 435
CspCI CAANNNNNGTGG 2 cut(s) 342, 377
CviAII CATG 4 cut(s) 82, 113, 220, 465
CviJI RGCY 9 cut(s) 5, 10, 44, 180, 240, 288, 314, 334, 483
CviKI_1 RGCY 9 cut(s) 5, 10, 44, 180, 240, 288, 314, 334, 483
DdeI CTNAG 1 cut(s) 330
Eco47I GGWCC 2 cut(s) 100, 174
EcoO109I RGGNCCY 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 435
FaeI CATG 4 cut(s) 85, 116, 223, 468
FalI AAGNNNNNCTT 2 cut(s) 291, 323
FatI CATG 4 cut(s) 81, 112, 219, 464
FspBI CTAG 1 cut(s) 450
HaeIII GGCC 1 cut(s) 483
Hin1II CATG 4 cut(s) 85, 116, 223, 468
HincII GTYRAC 1 cut(s) 433
HindII GTYRAC 1 cut(s) 433
HinfI GANTC 2 cut(s) 15, 157
HphI GGTGA 1 cut(s) 467
Hpy166II GTNNAC 1 cut(s) 433
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 82
Hpy8I GTNNAC 1 cut(s) 433
HpyCH4V TGCA 3 cut(s) 72, 404, 422
HpyF10VI GCNNNNNNNGC 1 cut(s) 320
HpyF3I CTNAG 1 cut(s) 330
Hsp92II CATG 4 cut(s) 85, 116, 223, 468
LpnPI CCDG 7 cut(s) 17, 38, 116, 157, 190, 422, 449
LweI GCATC 1 cut(s) 435
MabI ACCWGGT 1 cut(s) 435
MaeI CTAG 1 cut(s) 450
MaeIII GTNAC 2 cut(s) 27, 455
MboII GAAGA 1 cut(s) 216
MhlI GDGCHC 2 cut(s) 81, 262
MluCI AATT 4 cut(s) 57, 277, 399, 424
MlyI GAGTC 1 cut(s) 9
MnlI CCTC 5 cut(s) 32, 109, 181, 339, 446
MseI TTAA 2 cut(s) 60, 309
MspR9I CCNGG 1 cut(s) 437
MvaI CCWGG 1 cut(s) 437
MwoI GCNNNNNNNGC 1 cut(s) 320
NlaIII CATG 4 cut(s) 85, 116, 223, 468
NlaIV GGNNCC 4 cut(s) 101, 120, 217, 366
NmuCI GTSAC 2 cut(s) 27, 455
NspV TTCGAA 1 cut(s) 165
PagI TCATGA 1 cut(s) 81
PfeI GAWTC 1 cut(s) 157
PflMI CCANNNNNTGG 1 cut(s) 212
PleI GAGTC 1 cut(s) 9
PpsI GAGTC 1 cut(s) 9
PpuMI RGGWCCY 1 cut(s) 100
Psp5II RGGWCCY 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 435
PspGI CCWGG 1 cut(s) 435
PspN4I GGNNCC 4 cut(s) 101, 120, 217, 366
PspPI GGNCC 3 cut(s) 100, 174, 482
PspPPI RGGWCCY 1 cut(s) 100
SaqAI TTAA 2 cut(s) 60, 309
Sau96I GGNCC 3 cut(s) 100, 174, 482
SchI GAGTC 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 437
SduI GDGCHC 2 cut(s) 81, 262
SexAI ACCWGGT 1 cut(s) 435
SfaNI GCATC 1 cut(s) 435
SfcI CTRYAG 1 cut(s) 235
SfuI TTCGAA 1 cut(s) 165
SinI GGWCC 2 cut(s) 100, 174
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 4 cut(s) 57, 277, 399, 424
SspMI CTAG 1 cut(s) 450
StyD4I CCNGG 1 cut(s) 435
TaqI TCGA 1 cut(s) 165
TasI AATT 4 cut(s) 57, 277, 399, 424
TfiI GAWTC 1 cut(s) 157
Tru1I TTAA 2 cut(s) 60, 309
Tru9I TTAA 2 cut(s) 60, 309
TscAI CASTG 2 cut(s) 36, 79
TseFI GTSAC 2 cut(s) 27, 455
Tsp45I GTSAC 2 cut(s) 27, 455
TspDTI ATGAA 2 cut(s) 254, 400
TspRI CASTG 2 cut(s) 36, 79
Van91I CCANNNNNTGG 1 cut(s) 212
VpaK11BI GGWCC 2 cut(s) 100, 174
XapI RAATTY 1 cut(s) 277
XspI CTAG 1 cut(s) 450
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.