RchiOBHm_Chr6g0300961

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Reverse (-)
61580034 .. 61581825
1792 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGCGAAGAGATCAGATTTTGCGCAAAAGCTGCTGGATGATCTTCGGGTTAGGAAGGAACGAATGGCTGCACCAGCGCAGAGCTCAAACCGTTCAAACGCAATGGCTATAGGACCGATGAAGGCGCAAAACAGTACACTTGAACTGACATCTGCGGAGGTCAAACGGTTATGTATGATTTATAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VARLMGL

Protein Analysis

62

Amino Acids

6.93

Weight (kDa)

10.01

Isoelectric Point (pI)

61.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 24
AciI CCGC 1 cut(s) 155
AfaI GTAC 1 cut(s) 136
AgsI TTSAA 2 cut(s) 96, 143
AluBI AGCT 3 cut(s) 31, 84, 186
AluI AGCT 3 cut(s) 31, 84, 186
Alw21I GWGCWC 1 cut(s) 86
ApeKI GCWGC 2 cut(s) 31, 68
AspLEI GCGC 3 cut(s) 25, 79, 127
AspS9I GGNCC 1 cut(s) 113
AvaII GGWCC 1 cut(s) 113
BanII GRGCYC 1 cut(s) 86
Bbv12I GWGCWC 1 cut(s) 86
BbvI GCAGC 2 cut(s) 18, 55
BfaI CTAG 1 cut(s) 187
BfmI CTRYAG 1 cut(s) 108
BisI GCNGC 2 cut(s) 32, 69
BlsI GCNGC 2 cut(s) 33, 70
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 1 cut(s) 113
Bse3DI GCAATG 1 cut(s) 108
BseGI GGATG 1 cut(s) 43
BseMI GCAATG 1 cut(s) 108
BseXI GCAGC 2 cut(s) 18, 55
BsgI GTGCAG 1 cut(s) 54
BsiHKAI GWGCWC 1 cut(s) 86
Bsp1286I GDGCHC 1 cut(s) 86
Bsp143I GATC 2 cut(s) 11, 40
BspACI CCGC 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 108
BssMI GATC 2 cut(s) 11, 40
Bst4CI ACNGT 3 cut(s) 92, 134, 168
Bst6I CTCTTC 1 cut(s) 2
BstAPI GCANNNNNTGC 1 cut(s) 31
BstF5I GGATG 1 cut(s) 43
BstHHI GCGC 3 cut(s) 25, 79, 127
BstKTI GATC 2 cut(s) 14, 43
BstMBI GATC 2 cut(s) 11, 40
BstMWI GCNNNNNNNGC 2 cut(s) 31, 74
BstSFI CTRYAG 1 cut(s) 108
BstV1I GCAGC 2 cut(s) 18, 55
BtsCI GGATG 1 cut(s) 43
CfoI GCGC 3 cut(s) 25, 79, 127
Cfr13I GGNCC 1 cut(s) 113
Csp6I GTAC 1 cut(s) 135
CviJI RGCY 5 cut(s) 31, 68, 84, 107, 186
CviKI_1 RGCY 5 cut(s) 31, 68, 84, 107, 186
CviQI GTAC 1 cut(s) 135
DpnI GATC 2 cut(s) 13, 42
DpnII GATC 2 cut(s) 11, 40
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
Ecl136II GAGCTC 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 86
Eco47I GGWCC 1 cut(s) 113
Eco53kI GAGCTC 1 cut(s) 84
EcoICRI GAGCTC 1 cut(s) 84
EcoT38I GRGCYC 1 cut(s) 86
FaiI YATR 4 cut(s) 110, 172, 176, 183
Fnu4HI GCNGC 2 cut(s) 32, 69
FokI GGATG 1 cut(s) 50
FriOI GRGCYC 1 cut(s) 86
Fsp4HI GCNGC 2 cut(s) 32, 69
FspBI CTAG 1 cut(s) 187
FspI TGCGCA 1 cut(s) 24
GlaI GCGC 3 cut(s) 24, 78, 126
GluI GCNGC 2 cut(s) 32, 69
HhaI GCGC 3 cut(s) 25, 79, 127
Hin6I GCGC 3 cut(s) 23, 77, 125
HinP1I GCGC 3 cut(s) 23, 77, 125
Hpy166II GTNNAC 1 cut(s) 137
Hpy188I TCNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 137
HpyAV CCTTC 2 cut(s) 49, 115
HpyCH4III ACNGT 3 cut(s) 92, 134, 168
HpyCH4V TGCA 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 74
HspAI GCGC 3 cut(s) 23, 77, 125
Kzo9I GATC 2 cut(s) 11, 40
LpnPI CCDG 2 cut(s) 20, 87
Lsp1109I GCAGC 2 cut(s) 18, 55
MaeI CTAG 1 cut(s) 187
MalI GATC 2 cut(s) 13, 42
MboI GATC 2 cut(s) 11, 40
MboII GAAGA 2 cut(s) 19, 35
MhlI GDGCHC 1 cut(s) 86
MnlI CCTC 1 cut(s) 151
MwoI GCNNNNNNNGC 2 cut(s) 31, 74
NdeII GATC 2 cut(s) 11, 40
NsbI TGCGCA 1 cut(s) 24
PkrI GCNGC 2 cut(s) 33, 70
Psp124BI GAGCTC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 113
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SacI GAGCTC 1 cut(s) 86
SatI GCNGC 2 cut(s) 32, 69
Sau3AI GATC 2 cut(s) 11, 40
Sau96I GGNCC 1 cut(s) 113
SduI GDGCHC 1 cut(s) 86
SetI ASST 4 cut(s) 33, 86, 162, 188
SfcI CTRYAG 1 cut(s) 108
SgeI CNNG 4 cut(s) 47, 59, 86, 152
SinI GGWCC 1 cut(s) 113
SsiI CCGC 1 cut(s) 155
SspMI CTAG 1 cut(s) 187
SstI GAGCTC 1 cut(s) 86
TaaI ACNGT 3 cut(s) 92, 134, 168
TaqII GACCGA 1 cut(s) 130
TatI WGTACW 1 cut(s) 134
TseI GCWGC 2 cut(s) 31, 68
TspDTI ATGAA 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 113
XspI CTAG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.