RchiOBHm_Chr5g0002981

Core-2/I-Branching enzyme

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
1753677 .. 1754033
357 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 357 bp
ATGTTCTCCACCCCATTCATACTCTCTTTCGCCCTCCTTCTCTCTCTCCCCCTCCTCTTCCTCCTCGCCCCTTATTTCCTCCCTCATAACAACCAAATCCTAATCCCCACTGCCGATGAAATCGACTACCAGGCTCTCTTTGCCCACGTTGTCCTATCCAAATCCACATTCACCCGCCTTTCCTTCGATCCCAAAACTAAGCCCAAAATCGCTTTCCTCTTCCTCACCAACTTCGACCTCCACTTCGCCCCCTATGACACGTTCCTCTCCACTCCTTCTGCTACGTCTACAGCTTCCTCTTCATCTCCTCCACTTTTAATAAGTCCCAACCCACAACTGAGTCCAACACCGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.03

Weight (kDa)

6.22

Isoelectric Point (pI)

45.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 287
AciI CCGC 1 cut(s) 175
AclWI GGATC 1 cut(s) 182
AflIII ACRYGT 1 cut(s) 258
AjnI CCWGG 1 cut(s) 129
AjuI GAANNNNNNNTTGG 4 cut(s) 152, 184, 197, 229
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
AlwI GGATC 1 cut(s) 182
ArsI GACNNNNNNTTYG 2 cut(s) 227, 259
AsuHPI GGTGA 2 cut(s) 163, 217
BciT130I CCWGG 1 cut(s) 131
BfmI CTRYAG 1 cut(s) 288
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
BseBI CCWGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 329
BseRI GAGGAG 3 cut(s) 44, 53, 297
BslFI GGGAC 1 cut(s) 309
BsmFI GGGAC 1 cut(s) 309
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 1 cut(s) 175
BspCNI CTCAG 1 cut(s) 330
BspPI GGATC 1 cut(s) 182
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 131
Bst6I CTCTTC 3 cut(s) 62, 224, 304
BstDEI CTNAG 2 cut(s) 198, 338
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstSFI CTRYAG 1 cut(s) 288
BtsI GCAGTG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 108
CviJI RGCY 3 cut(s) 134, 202, 293
CviKI_1 RGCY 3 cut(s) 134, 202, 293
DdeI CTNAG 2 cut(s) 198, 338
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eam1104I CTCTTC 3 cut(s) 62, 224, 304
EarI CTCTTC 3 cut(s) 62, 224, 304
EcoRII CCWGG 1 cut(s) 129
FaiI YATR 3 cut(s) 20, 87, 255
FaqI GGGAC 1 cut(s) 309
FauI CCCGC 1 cut(s) 182
FblI GTMKAC 1 cut(s) 287
HinfI GANTC 1 cut(s) 340
HphI GGTGA 2 cut(s) 163, 217
Hpy166II GTNNAC 1 cut(s) 288
Hpy8I GTNNAC 1 cut(s) 288
HpyAV CCTTC 3 cut(s) 47, 193, 285
HpyCH4IV ACGT 3 cut(s) 147, 260, 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 198, 338
HpySE526I ACGT 3 cut(s) 147, 260, 284
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 2 cut(s) 116, 143
MaeII ACGT 3 cut(s) 147, 260, 284
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 3 cut(s) 49, 211, 291
MlyI GAGTC 1 cut(s) 349
MseI TTAA 1 cut(s) 317
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 1 cut(s) 187
PleI GAGTC 1 cut(s) 348
PpsI GAGTC 1 cut(s) 348
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 317
Sau3AI GATC 1 cut(s) 187
SchI GAGTC 1 cut(s) 349
ScrFI CCNGG 1 cut(s) 131
SetI ASST 5 cut(s) 150, 240, 263, 287, 295
SfcI CTRYAG 1 cut(s) 288
SgeI CNNG 6 cut(s) 77, 142, 143, 158, 186, 271
SsiI CCGC 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 129
TaiI ACGT 3 cut(s) 150, 263, 287
TaqI TCGA 3 cut(s) 123, 186, 234
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 3 cut(s) 7, 132, 291
TspRI CASTG 1 cut(s) 115
XmiI GTMKAC 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.