RchiOBHm_Chr5g0005281

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
3395408 .. 3395638
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGGTGTCAGATGGCAAGAACTGGAGACTTGGCTCAGAGGCACGAAATCCATGCAGCCTTTATGGAACATGTGGACCTTTTGGTACTTGCAACCCTTCTGAATCTCCAATATGCAAGTGTTTGAAAAGGGTTTGTACTCAAGTCAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

49

Amino Acids

5.28

Weight (kDa)

8.65

Isoelectric Point (pI)

41.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S_locus_glycop PF00954 3 - 42 6.9e-10 S-locus glycoprotein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 85, 136
AflIII ACRYGT 1 cut(s) 68
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Alw26I GTCTC 1 cut(s) 19
ApeKI GCWGC 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BbvI GCAGC 1 cut(s) 66
BccI CCATC 1 cut(s) 5
BcgI CGANNNNNNTGC 2 cut(s) 33, 67
BcoDI GTCTC 1 cut(s) 19
BisI GCNGC 1 cut(s) 55
BlsI GCNGC 1 cut(s) 56
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 66
BsmAI GTCTC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 47
BsrI ACTGG 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 72
BstV1I GCAGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 2 cut(s) 84, 135
CviAII CATG 2 cut(s) 51, 69
CviJI RGCY 3 cut(s) 33, 57, 147
CviKI_1 RGCY 3 cut(s) 33, 57, 147
CviQI GTAC 2 cut(s) 84, 135
DdeI CTNAG 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 74
FaeI CATG 2 cut(s) 54, 72
FaiI YATR 4 cut(s) 52, 63, 70, 112
FatI CATG 2 cut(s) 50, 68
Fnu4HI GCNGC 1 cut(s) 55
Fsp4HI GCNGC 1 cut(s) 55
GluI GCNGC 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 43
Hin1II CATG 2 cut(s) 54, 72
HinfI GANTC 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 3 cut(s) 10, 37, 100
Hpy8I GTNNAC 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 105
HpyCH4V TGCA 3 cut(s) 54, 90, 114
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 2 cut(s) 54, 72
LpnPI CCDG 1 cut(s) 7
Lsp1109I GCAGC 1 cut(s) 66
MnlI CCTC 1 cut(s) 31
MspA1I CMGCKG 1 cut(s) 147
NlaIII CATG 2 cut(s) 54, 72
NspI RCATGY 1 cut(s) 72
PciI ACATGT 1 cut(s) 68
PfeI GAWTC 1 cut(s) 101
PkrI GCNGC 1 cut(s) 56
PscI ACATGT 1 cut(s) 68
PspPI GGNCC 1 cut(s) 74
PvuII CAGCTG 1 cut(s) 147
RsaI GTAC 2 cut(s) 85, 136
RsaNI GTAC 2 cut(s) 84, 135
SatI GCNGC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 74
SetI ASST 2 cut(s) 79, 149
SgeI CNNG 8 cut(s) 28, 34, 41, 54, 63, 81, 99, 127
SinI GGWCC 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
TatI WGTACW 1 cut(s) 134
TfiI GAWTC 1 cut(s) 101
TseI GCWGC 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 74
XceI RCATGY 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.