RchiOBHm_Chr5g0005611

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
3596276 .. 3596886
611 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGGCACATGTAGTTCTCATGCTAAGTAGTAATACAGATGGTCCCCAACCTAAGGAGCCTATATTCACTATCCTGTATTCGACCATGCCAGTAATTCGTCCTCAACCACGGTATGAAAGTACTTGCTCCACAAATGACACTTGCATAACAGGGATTGAAGGACGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

55

Amino Acids

6.1

Weight (kDa)

5.54

Isoelectric Point (pI)

47.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 52
AflIII ACRYGT 1 cut(s) 7
AgsI TTSAA 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
AxyI CCTNAGG 1 cut(s) 51
BccI CCATC 1 cut(s) 32
BmcAI AGTACT 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 1 cut(s) 41
BmiI GGNNCC 2 cut(s) 43, 57
BsaJI CCNNGG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 89
Bse21I CCTNAGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 107
BseLI CCNNNNNNNGG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 89
BslFI GGGAC 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 27
BspLI GGNNCC 2 cut(s) 43, 57
BsrI ACTGG 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 111
BstDEI CTNAG 2 cut(s) 23, 51
BstDSI CCRYGG 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 11
Bsu36I CCTNAGG 1 cut(s) 51
BtgI CCRYGG 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 41
Csp6I GTAC 1 cut(s) 120
CviAII CATG 3 cut(s) 8, 19, 85
CviJI RGCY 1 cut(s) 58
CviKI_1 RGCY 1 cut(s) 58
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 2 cut(s) 23, 51
Eco47I GGWCC 1 cut(s) 41
Eco81I CCTNAGG 1 cut(s) 51
FaeI CATG 3 cut(s) 11, 22, 88
FaiI YATR 6 cut(s) 9, 20, 62, 86, 114, 146
FaqI GGGAC 1 cut(s) 27
FatI CATG 3 cut(s) 7, 18, 84
Hin1II CATG 3 cut(s) 11, 22, 88
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 2 cut(s) 23, 51
Hsp92II CATG 3 cut(s) 11, 22, 88
LmnI GCTCC 2 cut(s) 55, 131
LpnPI CCDG 3 cut(s) 86, 102, 135
MluCI AATT 1 cut(s) 93
MnlI CCTC 1 cut(s) 111
NlaIII CATG 3 cut(s) 11, 22, 88
NlaIV GGNNCC 2 cut(s) 43, 57
NspI RCATGY 1 cut(s) 11
PciI ACATGT 1 cut(s) 7
PscI ACATGT 1 cut(s) 7
PspN4I GGNNCC 2 cut(s) 43, 57
PspPI GGNCC 1 cut(s) 41
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 41
ScaI AGTACT 1 cut(s) 121
SetI ASST 1 cut(s) 52
SgeI CNNG 9 cut(s) 20, 31, 85, 97, 101, 120, 135, 153, 162
SinI GGWCC 1 cut(s) 41
Sse9I AATT 1 cut(s) 93
TaaI ACNGT 1 cut(s) 111
TaqI TCGA 1 cut(s) 80
TasI AATT 1 cut(s) 93
TatI WGTACW 1 cut(s) 119
TspDTI ATGAA 1 cut(s) 129
VpaK11BI GGWCC 1 cut(s) 41
XceI RCATGY 1 cut(s) 11
ZrmI AGTACT 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.