RchiOBHm_Chr5g0011871

Protein of unknown function (DUF2854)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
7900915 .. 7901740
826 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGTGTTTGGGCGTAAAAGATGCAAGAGGAGATGGAAAGGAGAATCTTGGCTTATGTGGTTGCAGATTTTATATGCCTATTGGAGCCATACCTTCTTCAATGCTAGGATTGGAGACTCTGACAGGAGACTTGGATTACTTTGGTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.18

Weight (kDa)

4.53

Isoelectric Point (pI)

38.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 99
Alw26I GTCTC 2 cut(s) 107, 120
AspS9I GGNCC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 143
BccI CCATC 1 cut(s) 26
BcoDI GTCTC 2 cut(s) 107, 120
BfaI CTAG 1 cut(s) 104
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 85
BmsI GCATC 1 cut(s) 10
BseRI GAGGAG 1 cut(s) 42
BsmAI GTCTC 2 cut(s) 107, 120
BspLI GGNNCC 1 cut(s) 85
BstMAI GTCTC 2 cut(s) 107, 120
Cfr13I GGNCC 1 cut(s) 143
CviJI RGCY 2 cut(s) 51, 86
CviKI_1 RGCY 2 cut(s) 51, 86
Eco47I GGWCC 1 cut(s) 143
FaiI YATR 4 cut(s) 55, 72, 74, 89
FspBI CTAG 1 cut(s) 104
HinfI GANTC 2 cut(s) 43, 115
Hpy188I TCNGA 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 23, 63
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 108
LweI GCATC 1 cut(s) 10
MaeI CTAG 1 cut(s) 104
MboII GAAGA 1 cut(s) 87
MlyI GAGTC 1 cut(s) 109
MnlI CCTC 1 cut(s) 20
MseI TTAA 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 85
PfeI GAWTC 1 cut(s) 43
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
PspN4I GGNNCC 1 cut(s) 85
PspPI GGNCC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 143
SchI GAGTC 1 cut(s) 109
SetI ASST 1 cut(s) 94
SfaNI GCATC 1 cut(s) 10
SgeI CNNG 5 cut(s) 36, 59, 116, 135, 142
SinI GGWCC 1 cut(s) 143
SspMI CTAG 1 cut(s) 104
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 143
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.