RchiOBHm_Chr5g0017521

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
12157288 .. 12157488
201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGATTTTCTAGGGAAGATGAAGATGATGATAAGGAGCGTGAGTGGACAAATGGACCATGGAATGGAAGATTATCTTGTGGCAGAAACTAGAAAAGTAAACGGCCATCAGTTGGGTTTATATGCAATCTTTGCAGGTCAACAAGTTGCAGAATACTTGCAAGCTCATCTATTTGATAAAATACTCAGGTATTACATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.67

Weight (kDa)

6.82

Isoelectric Point (pI)

36.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 125
AccB7I CCANNNNNTGG 2 cut(s) 64, 112
AcoI YGGCCR 1 cut(s) 103
AfiI CCNNNNNNNGG 2 cut(s) 64, 112
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AoxI GGCC 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 55
AvaII GGWCC 1 cut(s) 55
BccI CCATC 1 cut(s) 114
BceAI ACGGC 1 cut(s) 118
BfaI CTAG 2 cut(s) 11, 90
BfuAI ACCTGC 1 cut(s) 125
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 58
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 112
BseDI CCNNGG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 64, 112
BseMII CTCAG 1 cut(s) 199
BshFI GGCC 1 cut(s) 105
BslI CCNNNNNNNGG 2 cut(s) 64, 112
BsnI GGCC 1 cut(s) 105
Bsp19I CCATGG 1 cut(s) 58
BspANI GGCC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 198
BspMI ACCTGC 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 58
BssT1I CCWWGG 1 cut(s) 58
BstAPI GCANNNNNTGC 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 185
BstDSI CCRYGG 1 cut(s) 58
BstMWI GCNNNNNNNGC 1 cut(s) 131
BsuRI GGCC 1 cut(s) 105
BtgI CCRYGG 1 cut(s) 58
BveI ACCTGC 1 cut(s) 125
Cac8I GCNNGC 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 55
CviAII CATG 1 cut(s) 59
CviJI RGCY 2 cut(s) 105, 164
CviKI_1 RGCY 2 cut(s) 105, 164
DdeI CTNAG 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 103
Eco130I CCWWGG 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 55
EcoT14I CCWWGG 1 cut(s) 58
ErhI CCWWGG 1 cut(s) 58
FaeI CATG 1 cut(s) 62
FaiI YATR 3 cut(s) 60, 121, 123
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 1 cut(s) 58
FspBI CTAG 2 cut(s) 11, 90
HaeIII GGCC 1 cut(s) 105
Hin1II CATG 1 cut(s) 62
HincII GTYRAC 1 cut(s) 140
HindII GTYRAC 1 cut(s) 140
Hpy166II GTNNAC 3 cut(s) 47, 100, 140
Hpy8I GTNNAC 3 cut(s) 47, 100, 140
HpyCH4V TGCA 4 cut(s) 125, 134, 149, 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 185
Hsp92II CATG 1 cut(s) 62
LmnI GCTCC 1 cut(s) 36
LpnPI CCDG 2 cut(s) 120, 172
MaeI CTAG 2 cut(s) 11, 90
MboII GAAGA 3 cut(s) 28, 34, 80
MwoI GCNNNNNNNGC 1 cut(s) 131
NcoI CCATGG 1 cut(s) 58
NlaIII CATG 1 cut(s) 62
PflMI CCANNNNNTGG 2 cut(s) 64, 112
PspPI GGNCC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 55
SetI ASST 3 cut(s) 139, 166, 191
SgeI CNNG 9 cut(s) 23, 52, 71, 89, 102, 147, 155, 169, 173
SinI GGWCC 1 cut(s) 55
SspMI CTAG 2 cut(s) 11, 90
StyI CCWWGG 1 cut(s) 58
TspDTI ATGAA 1 cut(s) 35
Van91I CCANNNNNTGG 2 cut(s) 64, 112
VpaK11BI GGWCC 1 cut(s) 55
XspI CTAG 2 cut(s) 11, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.