RchiOBHm_Chr5g0022561

ABC transporter D family member 2

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
16654416 .. 16656454
2039 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGCAACTTTTGCTGCAACGCTTCAAAAGTGCTGTTGAGAATCTAACTCAATTGTTGATATATTCAAGAAATCCTGAGTTTTCACTAGTGGATACCGCTATCTTATTCAAATTCTTCCTGCTGCTGTCGTTGCTCCTATGTACTTCTCTGGAAAAATTGAGTTTGGTGTCATTAATCAGTCAGTATCTGCTTTTAATCATATCCTGGGGAACTTCTCCCTTATCGTGTGCCAATTTCAGTCTATAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.18

Weight (kDa)

7.78

Isoelectric Point (pI)

22.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 96
AcsI RAATTY 1 cut(s) 110
AfaI GTAC 1 cut(s) 142
AgsI TTSAA 3 cut(s) 25, 66, 109
AhlI ACTAGT 1 cut(s) 85
AjnI CCWGG 1 cut(s) 203
AlwNI CAGNNNCTG 1 cut(s) 187
ApeKI GCWGC 2 cut(s) 13, 121
ApoI RAATTY 1 cut(s) 110
AseI ATTAAT 1 cut(s) 173
BbvI GCAGC 1 cut(s) 108
BciT130I CCWGG 1 cut(s) 205
BciVI GTATCC 1 cut(s) 85
BcuI ACTAGT 1 cut(s) 85
BfaI CTAG 1 cut(s) 86
BfuI GTATCC 1 cut(s) 85
BisI GCNGC 2 cut(s) 14, 122
BlsI GCNGC 2 cut(s) 15, 123
Bme1390I CCNGG 1 cut(s) 205
BmrFI CCNGG 1 cut(s) 205
BsaJI CCNNGG 1 cut(s) 204
BseBI CCWGG 1 cut(s) 205
BseDI CCNNGG 1 cut(s) 204
BseMII CTCAG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 108
BspACI CCGC 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 205
BstAPI GCANNNNNTGC 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 75
BstMWI GCNNNNNNNGC 2 cut(s) 10, 130
BstNI CCWGG 1 cut(s) 205
BstSCI CCNGG 1 cut(s) 203
BstV1I GCAGC 1 cut(s) 108
BsuI GTATCC 1 cut(s) 85
CaiI CAGNNNCTG 1 cut(s) 187
Csp6I GTAC 1 cut(s) 141
CviQI GTAC 1 cut(s) 141
DdeI CTNAG 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 203
FaiI YATR 4 cut(s) 61, 139, 200, 244
Fnu4HI GCNGC 2 cut(s) 14, 122
Fsp4HI GCNGC 2 cut(s) 14, 122
FspBI CTAG 1 cut(s) 86
GluI GCNGC 2 cut(s) 14, 122
HinfI GANTC 1 cut(s) 40
Hpy188III TCNNGA 3 cut(s) 66, 74, 149
HpyCH4V TGCA 2 cut(s) 4, 16
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 130
HpyF3I CTNAG 1 cut(s) 75
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 5 cut(s) 87, 131, 134, 190, 217
Lsp1109I GCAGC 1 cut(s) 108
MaeI CTAG 1 cut(s) 86
MboII GAAGA 1 cut(s) 106
MfeI CAATTG 1 cut(s) 50
MluCI AATT 4 cut(s) 50, 110, 155, 232
MseI TTAA 2 cut(s) 173, 194
MspR9I CCNGG 1 cut(s) 205
MunI CAATTG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 205
MwoI GCNNNNNNNGC 2 cut(s) 10, 130
PfeI GAWTC 1 cut(s) 40
PkrI GCNGC 2 cut(s) 15, 123
PshBI ATTAAT 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 203
PspGI CCWGG 1 cut(s) 203
PstNI CAGNNNCTG 1 cut(s) 187
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SaqAI TTAA 2 cut(s) 173, 194
SatI GCNGC 2 cut(s) 14, 122
ScrFI CCNGG 1 cut(s) 205
SgeI CNNG 8 cut(s) 78, 86, 98, 130, 161, 216, 217, 237
SpeI ACTAGT 1 cut(s) 85
Sse9I AATT 4 cut(s) 50, 110, 155, 232
SsiI CCGC 1 cut(s) 96
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 203
TasI AATT 4 cut(s) 50, 110, 155, 232
TatI WGTACW 1 cut(s) 140
TfiI GAWTC 1 cut(s) 40
Tru1I TTAA 2 cut(s) 173, 194
Tru9I TTAA 2 cut(s) 173, 194
TseI GCWGC 2 cut(s) 13, 121
VspI ATTAAT 1 cut(s) 173
XapI RAATTY 1 cut(s) 110
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.