RchiOBHm_Chr5g0022871

RING-like zinc finger

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
16919845 .. 16920907
1063 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGGATGCAATCAATGGCTCTGCAGACAAGAATGTATCTCAGGCGTGTCCTGTGGTTATGCGTCCAAGTAGTTCTTCTCCACAAGGGATTGGGAATTCCCGTTCTGACTTTTTTCCCGTTTGTCGTGGTTTGAGAGAGAGAGAGAGGACCCAAAAAGGAAAAAAGAAAAATCTGTCTTTGAGGGTATTTTAG

Protein Analysis

63

Amino Acids

6.94

Weight (kDa)

10.52

Isoelectric Point (pI)

58.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030179)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0022871 RchiOBHm_Chr6g0275611

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 94
AjuI GAANNNNNNNTTGG 2 cut(s) 58, 90
AloI GAACNNNNNNTCC 2 cut(s) 85, 117
ApoI RAATTY 1 cut(s) 94
AspS9I GGNCC 1 cut(s) 147
AvaII GGWCC 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 147
BmiI GGNNCC 1 cut(s) 149
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 149
BspMAI CTGCAG 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 147
CseI GACGC 1 cut(s) 50
CviJI RGCY 1 cut(s) 18
CviKI_1 RGCY 1 cut(s) 18
DdeI CTNAG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 147
EcoO109I RGGNCCY 1 cut(s) 147
EcoRI GAATTC 1 cut(s) 94
FaiI YATR 1 cut(s) 59
FalI AAGNNNNNCTT 2 cut(s) 58, 90
FokI GGATG 1 cut(s) 17
HgaI GACGC 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 8, 23
HpyF3I CTNAG 1 cut(s) 39
LpnPI CCDG 2 cut(s) 26, 63
MboII GAAGA 1 cut(s) 66
MluCI AATT 1 cut(s) 94
MnlI CCTC 2 cut(s) 138, 174
NlaIV GGNNCC 1 cut(s) 149
PpuMI RGGWCCY 1 cut(s) 147
Psp5II RGGWCCY 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 149
PspPI GGNCC 1 cut(s) 147
PspPPI RGGWCCY 1 cut(s) 147
PstI CTGCAG 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 147
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 9 cut(s) 40, 53, 57, 62, 78, 95, 111, 128, 137
SinI GGWCC 1 cut(s) 147
Sse9I AATT 1 cut(s) 94
TasI AATT 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 147
XapI RAATTY 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.