RchiOBHm_Chr5g0024991

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
19012316 .. 19012574
259 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGTCTACAGTTTTGGAGTATTACTGCTTGAGAATTGAGATCATAAGTGGGAGGAAAAGCAATAGCTTCTACAATGATGATCATGTGCACAATATAGTAGGATATGCATGGAGATTATGGAACGAAGGTACATGGCTAGAACTAATGGATCCCAACATTAGGCGATTCATGTAA

Protein Analysis

57

Amino Acids

6.95

Weight (kDa)

6.02

Isoelectric Point (pI)

76.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 2 cut(s) 143, 156
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 159
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 90
Alw44I GTGCAC 1 cut(s) 86
AlwI GGATC 2 cut(s) 143, 156
ApaLI GTGCAC 1 cut(s) 86
BaeGI GKGCMC 1 cut(s) 90
BamHI GGATCC 1 cut(s) 148
Bbv12I GWGCWC 1 cut(s) 90
BclI TGATCA 1 cut(s) 79
BfaI CTAG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 49
Bsc4I CCNNNNNNNGG 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 159
BseSI GKGCMC 1 cut(s) 90
BsiHKAI GWGCWC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 3 cut(s) 39, 79, 148
BspLI GGNNCC 1 cut(s) 150
BspPI GGATC 2 cut(s) 143, 156
BssMI GATC 3 cut(s) 39, 79, 148
Bst4CI ACNGT 1 cut(s) 10
BstKTI GATC 3 cut(s) 42, 82, 151
BstMBI GATC 3 cut(s) 39, 79, 148
BstSFI CTRYAG 1 cut(s) 6
BstSLI GKGCMC 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 148
BstYI RGATCY 1 cut(s) 148
Csp6I GTAC 1 cut(s) 129
CviAII CATG 4 cut(s) 83, 108, 132, 169
CviJI RGCY 2 cut(s) 66, 136
CviKI_1 RGCY 2 cut(s) 66, 136
CviQI GTAC 1 cut(s) 129
DpnI GATC 3 cut(s) 41, 81, 150
DpnII GATC 3 cut(s) 39, 79, 148
EcoT22I ATGCAT 1 cut(s) 109
FaeI CATG 4 cut(s) 86, 111, 135, 172
FaiI YATR 8 cut(s) 44, 84, 95, 105, 109, 118, 133, 170
FatI CATG 4 cut(s) 82, 107, 131, 168
FbaI TGATCA 1 cut(s) 79
FblI GTMKAC 1 cut(s) 5
FspBI CTAG 1 cut(s) 137
Hin1II CATG 4 cut(s) 86, 111, 135, 172
HinfI GANTC 1 cut(s) 165
Hpy166II GTNNAC 2 cut(s) 6, 88
Hpy8I GTNNAC 2 cut(s) 6, 88
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 88, 107
Hsp92II CATG 4 cut(s) 86, 111, 135, 172
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 3 cut(s) 39, 79, 148
MaeI CTAG 1 cut(s) 137
MalI GATC 3 cut(s) 41, 81, 150
MboI GATC 3 cut(s) 39, 79, 148
MflI RGATCY 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 90
MluCI AATT 1 cut(s) 33
MnlI CCTC 1 cut(s) 45
Mph1103I ATGCAT 1 cut(s) 109
NdeII GATC 3 cut(s) 39, 79, 148
NlaIII CATG 4 cut(s) 86, 111, 135, 172
NlaIV GGNNCC 1 cut(s) 150
NsiI ATGCAT 1 cut(s) 109
PfeI GAWTC 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 150
PsuI RGATCY 1 cut(s) 148
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
Sau3AI GATC 3 cut(s) 39, 79, 148
SduI GDGCHC 1 cut(s) 90
SetI ASST 2 cut(s) 68, 130
SfcI CTRYAG 1 cut(s) 6
SgeI CNNG 5 cut(s) 40, 95, 120, 144, 149
SmlI CTYRAG 1 cut(s) 28
SmoI CTYRAG 1 cut(s) 28
Sse9I AATT 1 cut(s) 33
SspMI CTAG 1 cut(s) 137
TaaI ACNGT 1 cut(s) 10
TasI AATT 1 cut(s) 33
TfiI GAWTC 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 157
VneI GTGCAC 1 cut(s) 86
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 1 cut(s) 137
Zsp2I ATGCAT 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.