RchiOBHm_Chr5g0028731

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
22567991 .. 22568338
348 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGTTTGAACTCCTCAAAGAGCAAGTAATGCTTGTAGGAAATGCCATACAAAGTGTGTACATACCAGGATGGAGGTTTCTACCAACGAAGATGAACACGAGGATGAAGAAAATTGACAAAGAGGTAAAAGGTTTACTTAAGGGTATAATAAATAAAGAGAGAGGGCCACTGGGGCTGGTGAAGCCTCTAAACATGACTTATTAG

Protein Analysis

67

Amino Acids

7.72

Weight (kDa)

10.07

Isoelectric Point (pI)

13.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 59
AflII CTTAAG 1 cut(s) 137
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 64
AoxI GGCC 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 190
BauI CACGAG 1 cut(s) 97
BccI CCATC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 66
BfrI CTTAAG 1 cut(s) 137
BglI GCCNNNNNGGC 1 cut(s) 172
Bme1390I CCNGG 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 66
BmrI ACTGGG 1 cut(s) 179
BmuI ACTGGG 1 cut(s) 179
Bse1I ACTGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 66
BseGI GGATG 2 cut(s) 74, 108
BseNI ACTGG 1 cut(s) 174
BshFI GGCC 1 cut(s) 166
BsnI GGCC 1 cut(s) 166
Bsp1407I TGTACA 1 cut(s) 57
BspANI GGCC 1 cut(s) 166
BspTI CTTAAG 1 cut(s) 137
BsrGI TGTACA 1 cut(s) 57
BsrI ACTGG 1 cut(s) 174
BssSI CACGAG 1 cut(s) 97
Bst2BI CACGAG 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 66
BstAFI CTTAAG 1 cut(s) 137
BstAPI GCANNNNNTGC 1 cut(s) 28
BstAUI TGTACA 1 cut(s) 57
BstF5I GGATG 2 cut(s) 74, 108
BstMWI GCNNNNNNNGC 3 cut(s) 28, 172, 181
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BsuRI GGCC 1 cut(s) 166
BtsCI GGATG 2 cut(s) 74, 108
BtsIMutI CAGTG 1 cut(s) 167
Cfr13I GGNCC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 58
CviAII CATG 1 cut(s) 193
CviJI RGCY 3 cut(s) 166, 175, 184
CviKI_1 RGCY 3 cut(s) 166, 175, 184
CviQI GTAC 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 64
FaeI CATG 1 cut(s) 196
FaiI YATR 4 cut(s) 47, 62, 146, 194
FalI AAGNNNNNCTT 4 cut(s) 15, 47, 120, 152
FatI CATG 1 cut(s) 192
FokI GGATG 2 cut(s) 81, 115
HaeIII GGCC 1 cut(s) 166
Hin1II CATG 1 cut(s) 196
HphI GGTGA 1 cut(s) 190
Hpy166II GTNNAC 2 cut(s) 58, 134
Hpy8I GTNNAC 2 cut(s) 58, 134
HpyF10VI GCNNNNNNNGC 3 cut(s) 28, 172, 181
Hsp92II CATG 1 cut(s) 196
LpnPI CCDG 4 cut(s) 51, 78, 155, 161
MboII GAAGA 2 cut(s) 100, 118
MluCI AATT 1 cut(s) 111
MnlI CCTC 6 cut(s) 23, 66, 93, 115, 155, 195
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 101
MspCI CTTAAG 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
MwoI GCNNNNNNNGC 3 cut(s) 28, 172, 181
NlaIII CATG 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
PspPI GGNCC 1 cut(s) 164
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 66
SetI ASST 3 cut(s) 77, 126, 133
SgeI CNNG 8 cut(s) 35, 44, 77, 78, 109, 111, 182, 188
SmiMI CAYNNNNRTG 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 137
SmoI CTYRAG 1 cut(s) 137
Sse9I AATT 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 64
TasI AATT 1 cut(s) 111
TatI WGTACW 1 cut(s) 57
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 174
TspDTI ATGAA 2 cut(s) 107, 119
TspRI CASTG 1 cut(s) 174
Vha464I CTTAAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.