RchiOBHm_Chr5g0028901

DNA-binding transcription factor activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
22685684 .. 22688194
2511 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGAATATTTCTGTCTTTCATCCGAGTGTGATAATCGGTTGTTCCGCATAATATTTCAAATGCCAAAATTGGAAAAGTATCCTTTCCTCAAGGCATCCACCCCTCCAATTCGTTGTATCTCAATGAGCCATAATACTCCGGTCGATCTCCTCTCTCACGTTAGGAAGATCACCATATGCACCGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.24

Weight (kDa)

8.84

Isoelectric Point (pI)

56.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 46, 183
AgsI TTSAA 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 163
BciVI GTATCC 1 cut(s) 90
BfuI GTATCC 1 cut(s) 90
BmsI GCATC 1 cut(s) 104
BpuEI CTTGAG 1 cut(s) 74
BsaWI WCCGGW 1 cut(s) 139
BseGI GGATG 2 cut(s) 20, 95
BseRI GAGGAG 1 cut(s) 140
Bsh1285I CGRYCG 1 cut(s) 144
BsiEI CGRYCG 1 cut(s) 144
BsiSI CCGG 1 cut(s) 140
Bsp143I GATC 2 cut(s) 145, 168
BspACI CCGC 2 cut(s) 46, 183
BssMI GATC 2 cut(s) 145, 168
BstF5I GGATG 2 cut(s) 20, 95
BstKTI GATC 2 cut(s) 148, 171
BstMBI GATC 2 cut(s) 145, 168
BstMCI CGRYCG 1 cut(s) 144
BsuI GTATCC 1 cut(s) 90
BtsCI GGATG 2 cut(s) 20, 95
CviJI RGCY 1 cut(s) 129
CviKI_1 RGCY 1 cut(s) 129
DpnI GATC 2 cut(s) 147, 170
DpnII GATC 2 cut(s) 145, 168
FaiI YATR 4 cut(s) 50, 132, 176, 178
FauNDI CATATG 1 cut(s) 176
FokI GGATG 2 cut(s) 7, 82
HapII CCGG 1 cut(s) 140
HpaII CCGG 1 cut(s) 140
HphI GGTGA 1 cut(s) 163
Hpy188I TCNGA 1 cut(s) 25
HpyCH4IV ACGT 1 cut(s) 159
HpyCH4V TGCA 1 cut(s) 180
HpySE526I ACGT 1 cut(s) 159
Kzo9I GATC 2 cut(s) 145, 168
LpnPI CCDG 1 cut(s) 153
LweI GCATC 1 cut(s) 104
MaeII ACGT 1 cut(s) 159
MalI GATC 2 cut(s) 147, 170
MboI GATC 2 cut(s) 145, 168
MboII GAAGA 1 cut(s) 178
MluCI AATT 2 cut(s) 68, 108
MnlI CCTC 3 cut(s) 98, 114, 161
MseI TTAA 1 cut(s) 187
MslI CAYNNNNRTG 1 cut(s) 25
MspI CCGG 1 cut(s) 140
NdeI CATATG 1 cut(s) 176
NdeII GATC 2 cut(s) 145, 168
RseI CAYNNNNRTG 1 cut(s) 25
SaqAI TTAA 1 cut(s) 187
Sau3AI GATC 2 cut(s) 145, 168
SetI ASST 1 cut(s) 162
SfaNI GCATC 1 cut(s) 104
SgeI CNNG 4 cut(s) 37, 103, 152, 170
SmiMI CAYNNNNRTG 1 cut(s) 25
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 2 cut(s) 68, 108
SsiI CCGC 2 cut(s) 46, 183
SspI AATATT 2 cut(s) 8, 54
TaiI ACGT 1 cut(s) 162
TaqI TCGA 1 cut(s) 144
TasI AATT 2 cut(s) 68, 108
Tru1I TTAA 1 cut(s) 187
Tru9I TTAA 1 cut(s) 187
TspDTI ATGAA 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.