RchiOBHm_Chr5g0034531

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
28386075 .. 28387411
1337 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGTTCAATAAATATTACAGAGATCAGACTGATATGTTTTTGCTATGTGCTGGTTTAACCAAATGCCTGATGCCATATACATTTTTACAGATTACTGGATTATGCAAGCTTCTCAACCAGAACAGTGAAAGTTTAACGTCGCTTGAATTCATTCATTGTACACTTTCTTCAGCTACTATATATCACAGCTTCTATCACAGCAAGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.04

Weight (kDa)

7.69

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 146
AcuI CTGAAG 1 cut(s) 153
AfaI GTAC 1 cut(s) 160
AgsI TTSAA 2 cut(s) 7, 146
AluBI AGCT 3 cut(s) 109, 173, 189
AluI AGCT 3 cut(s) 109, 173, 189
ApoI RAATTY 1 cut(s) 146
Asp700I GAANNNNTTC 1 cut(s) 150
BarI GAAGNNNNNNTAC 2 cut(s) 151, 183
BmsI GCATC 1 cut(s) 60
Bse1I ACTGG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 100
Bsp1407I TGTACA 1 cut(s) 158
Bsp143I GATC 1 cut(s) 22
BsrGI TGTACA 1 cut(s) 158
BsrI ACTGG 1 cut(s) 100
BssMI GATC 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 125
BstAUI TGTACA 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 107
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 159
CviJI RGCY 3 cut(s) 109, 173, 189
CviKI_1 RGCY 3 cut(s) 109, 173, 189
CviQI GTAC 1 cut(s) 159
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 153
EcoRI GAATTC 1 cut(s) 146
FaiI YATR 7 cut(s) 35, 46, 76, 78, 103, 179, 181
FspEI CC 6 cut(s) 36, 73, 80, 81, 87, 131
HindIII AAGCTT 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 27
Hpy8I GTNNAC 1 cut(s) 161
Hpy99I CGWCG 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4IV ACGT 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 137
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 4 cut(s) 36, 80, 81, 131
LweI GCATC 1 cut(s) 60
MaeII ACGT 1 cut(s) 137
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 1 cut(s) 159
MluCI AATT 1 cut(s) 146
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 2 cut(s) 56, 134
NdeII GATC 1 cut(s) 22
PdmI GAANNNNTTC 1 cut(s) 150
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SaqAI TTAA 2 cut(s) 56, 134
Sau3AI GATC 1 cut(s) 22
SetI ASST 4 cut(s) 111, 140, 175, 191
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 6 cut(s) 63, 79, 108, 118, 130, 155
Sse9I AATT 1 cut(s) 146
SspI AATATT 1 cut(s) 14
TaaI ACNGT 1 cut(s) 125
TaiI ACGT 1 cut(s) 140
TasI AATT 1 cut(s) 146
TatI WGTACW 1 cut(s) 158
Tru1I TTAA 2 cut(s) 56, 134
Tru9I TTAA 2 cut(s) 56, 134
TscAI CASTG 1 cut(s) 130
TspDTI ATGAA 2 cut(s) 139, 143
TspRI CASTG 1 cut(s) 130
XapI RAATTY 1 cut(s) 146
XmnI GAANNNNTTC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.