RchiOBHm_Chr5g0036151

Photosystem I reaction center subunit psaK

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
30283103 .. 30283285
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGCTAACTGTATCTTCTTCCTTTTTGTTTCATATAATGGTGACTACTATAAGCCTAATGTTGTTTGCTAGGAGATTCGGGTTGGCGCCATCTACAAACAGGAAGGCAACAGCAGGATTGAGGCTCAAAATGAGGGACACAGGACTTCAGACCGGTGACCCAGCTTGTTTCACCCTTTGCTGA

Protein Analysis

60

Amino Acids

6.6

Weight (kDa)

10.81

Isoelectric Point (pI)

52.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 85
AcuI CTGAAG 1 cut(s) 131
AcyI GRCGYC 1 cut(s) 86
AgeI ACCGGT 1 cut(s) 152
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AsiGI ACCGGT 1 cut(s) 152
AspLEI GCGC 1 cut(s) 88
AsuHPI GGTGA 3 cut(s) 52, 163, 167
BanI GGYRCC 1 cut(s) 85
BccI CCATC 1 cut(s) 97
BfaI CTAG 1 cut(s) 69
BfoI RGCGCY 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 87
BsaHI GRCGYC 1 cut(s) 86
BsaWI WCCGGW 1 cut(s) 152
Bse118I RCCGGY 1 cut(s) 152
BseYI CCCAGC 1 cut(s) 160
BshNI GGYRCC 1 cut(s) 85
BshTI ACCGGT 1 cut(s) 152
BsiSI CCGG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 149
BsmFI GGGAC 1 cut(s) 149
BspLI GGNNCC 1 cut(s) 87
BspT107I GGYRCC 1 cut(s) 85
BsrFI RCCGGY 1 cut(s) 152
BssAI RCCGGY 1 cut(s) 152
BssNI GRCGYC 1 cut(s) 86
Bst4CI ACNGT 1 cut(s) 10
BstACI GRCGYC 1 cut(s) 86
BstEII GGTNACC 1 cut(s) 155
BstH2I RGCGCY 1 cut(s) 89
BstHHI GCGC 1 cut(s) 88
BstPI GGTNACC 1 cut(s) 155
CfoI GCGC 1 cut(s) 88
Cfr10I RCCGGY 1 cut(s) 152
CspAI ACCGGT 1 cut(s) 152
CviJI RGCY 3 cut(s) 54, 124, 164
CviKI_1 RGCY 3 cut(s) 54, 124, 164
DinI GGCGCC 1 cut(s) 87
Eco57I CTGAAG 1 cut(s) 131
Eco91I GGTNACC 1 cut(s) 155
EcoO65I GGTNACC 1 cut(s) 155
EgeI GGCGCC 1 cut(s) 87
EheI GGCGCC 1 cut(s) 87
FaiI YATR 3 cut(s) 33, 35, 50
FaqI GGGAC 1 cut(s) 149
FspBI CTAG 1 cut(s) 69
GlaI GCGC 1 cut(s) 87
GsaI CCCAGC 1 cut(s) 164
HaeII RGCGCY 1 cut(s) 89
HapII CCGG 1 cut(s) 153
HhaI GCGC 1 cut(s) 88
Hin1I GRCGYC 1 cut(s) 86
Hin6I GCGC 1 cut(s) 86
HinP1I GCGC 1 cut(s) 86
HinfI GANTC 1 cut(s) 75
HpaII CCGG 1 cut(s) 153
HphI GGTGA 3 cut(s) 52, 163, 167
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 1 cut(s) 10
Hsp92I GRCGYC 1 cut(s) 86
HspAI GCGC 1 cut(s) 86
KasI GGCGCC 1 cut(s) 85
LpnPI CCDG 5 cut(s) 85, 99, 126, 166, 174
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 2 cut(s) 40, 155
MboII GAAGA 2 cut(s) 6, 9
Mly113I GGCGCC 1 cut(s) 86
MnlI CCTC 2 cut(s) 114, 126
MspI CCGG 1 cut(s) 153
NarI GGCGCC 1 cut(s) 86
NlaIV GGNNCC 1 cut(s) 87
NmuCI GTSAC 2 cut(s) 40, 155
PfeI GAWTC 1 cut(s) 75
PinAI ACCGGT 1 cut(s) 152
PluTI GGCGCC 1 cut(s) 89
PspEI GGTNACC 1 cut(s) 155
PspFI CCCAGC 1 cut(s) 160
PspN4I GGNNCC 1 cut(s) 87
SetI ASST 1 cut(s) 166
SfoI GGCGCC 1 cut(s) 87
SgeI CNNG 8 cut(s) 81, 91, 112, 126, 153, 165, 173, 177
SspDI GGCGCC 1 cut(s) 85
SspMI CTAG 1 cut(s) 69
TaaI ACNGT 1 cut(s) 10
TfiI GAWTC 1 cut(s) 75
TseFI GTSAC 2 cut(s) 40, 155
Tsp45I GTSAC 2 cut(s) 40, 155
TspDTI ATGAA 1 cut(s) 20
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.