RchiOBHm_Chr5g0037501

Bifunctional aspartate aminotransferase and glutamate aspartate-prephenate

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
32016847 .. 32017218
372 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGTCAATTCAGGCGAGGATCAATGCGATTCGGGAGAGGTATACCAGGTACACACCAAATGCAGGGACTTTGGAGTTGCATCAGCAATTTTATGGGATCTCTTACACACCTGATCAGGTTTTGGTTAGTAATGGAGCCAAGCAGTGTATTGATCAAGGAGTTTCGTTCAGGTTATGTCTGATGAAATTTATGAACACATAA

Protein Analysis

66

Amino Acids

7.59

Weight (kDa)

9.18

Isoelectric Point (pI)

11.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 41
AclWI GGATC 2 cut(s) 26, 104
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 62
AjnI CCWGG 1 cut(s) 44
AlwI GGATC 2 cut(s) 26, 104
ApoI RAATTY 1 cut(s) 185
BciT130I CCWGG 1 cut(s) 46
BclI TGATCA 2 cut(s) 112, 151
Bme1390I CCNGG 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 46
BmsI GCATC 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 79
Bsp143I GATC 4 cut(s) 18, 96, 112, 151
BspLI GGNNCC 1 cut(s) 136
BspPI GGATC 2 cut(s) 26, 104
BssMI GATC 4 cut(s) 18, 96, 112, 151
BssNAI GTATAC 1 cut(s) 42
Bst1107I GTATAC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 46
BstKTI GATC 4 cut(s) 21, 99, 115, 154
BstMBI GATC 4 cut(s) 18, 96, 112, 151
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BstZ17I GTATAC 1 cut(s) 42
BtsI GCAGTG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 149
CsiI ACCWGGT 1 cut(s) 44
Csp6I GTAC 1 cut(s) 49
CviJI RGCY 1 cut(s) 137
CviKI_1 RGCY 1 cut(s) 137
CviQI GTAC 1 cut(s) 49
DpnI GATC 4 cut(s) 20, 98, 114, 153
DpnII GATC 4 cut(s) 18, 96, 112, 151
EcoRII CCWGG 1 cut(s) 44
FaiI YATR 5 cut(s) 42, 93, 175, 191, 199
FaqI GGGAC 1 cut(s) 79
FbaI TGATCA 2 cut(s) 112, 151
FblI GTMKAC 1 cut(s) 41
HinfI GANTC 1 cut(s) 28
Hpy166II GTNNAC 2 cut(s) 42, 51
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 2 cut(s) 42, 51
HpyCH4V TGCA 2 cut(s) 62, 79
Ksp22I TGATCA 2 cut(s) 112, 151
Kzo9I GATC 4 cut(s) 18, 96, 112, 151
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 6 cut(s) 31, 48, 58, 101, 123, 154
LweI GCATC 1 cut(s) 88
MabI ACCWGGT 1 cut(s) 44
MalI GATC 4 cut(s) 20, 98, 114, 153
MboI GATC 4 cut(s) 18, 96, 112, 151
MflI RGATCY 1 cut(s) 96
MluCI AATT 3 cut(s) 6, 86, 185
MnlI CCTC 2 cut(s) 9, 30
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
NdeII GATC 4 cut(s) 18, 96, 112, 151
NlaIV GGNNCC 1 cut(s) 136
PfeI GAWTC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 136
PsuI RGATCY 1 cut(s) 96
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
Sau3AI GATC 4 cut(s) 18, 96, 112, 151
ScrFI CCNGG 1 cut(s) 46
SetI ASST 5 cut(s) 41, 50, 112, 120, 173
SexAI ACCWGGT 1 cut(s) 44
SfaNI GCATC 1 cut(s) 88
Sse9I AATT 3 cut(s) 6, 86, 185
StyD4I CCNGG 1 cut(s) 44
TasI AATT 3 cut(s) 6, 86, 185
TfiI GAWTC 1 cut(s) 28
TscAI CASTG 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 197
TspRI CASTG 1 cut(s) 149
XapI RAATTY 1 cut(s) 185
XmiI GTMKAC 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.