RchiOBHm_Chr5g0038091

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
32735946 .. 32736140
195 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGCAAGTTGGAGAAGTTGCTCGACTGCATTGCTTTCCTGATTATGCTTATGGACCTAGTGGATTTCCAGCCTGGGGCATACAACCTTATTCGGTTTTGGTCTTTGAGATTGAGCTACTAAGAGTTGGAATATCTGCAAATCTATACGATATTCTAAGTAACTTGCTTCGCCTCAGGAATATACAATTATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.23

Weight (kDa)

5.54

Isoelectric Point (pI)

50.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FKBP_C PF00254 1 - 40 1.2e-07 FKBP-type peptidyl-prolyl cis-trans isomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 74
AjnI CCWGG 1 cut(s) 71
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 53
AvaII GGWCC 1 cut(s) 53
AxyI CCTNAGG 1 cut(s) 173
BcgI CGANNNNNNTGC 2 cut(s) 12, 46
BciT130I CCWGG 1 cut(s) 73
BfaI CTAG 1 cut(s) 57
Bme1390I CCNGG 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse21I CCTNAGG 1 cut(s) 173
Bse3DI GCAATG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 187
BslI CCNNNNNNNGG 1 cut(s) 74
BspCNI CTCAG 1 cut(s) 186
BspHI TCATGA 1 cut(s) 191
BsrDI GCAATG 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 73
BstDEI CTNAG 3 cut(s) 119, 155, 173
BstNI CCWGG 1 cut(s) 73
BstSCI CCNGG 1 cut(s) 71
Bsu36I CCTNAGG 1 cut(s) 173
CciI TCATGA 1 cut(s) 191
Cfr13I GGNCC 1 cut(s) 53
CviAII CATG 1 cut(s) 192
CviJI RGCY 2 cut(s) 71, 115
CviKI_1 RGCY 2 cut(s) 71, 115
DdeI CTNAG 3 cut(s) 119, 155, 173
Eco47I GGWCC 1 cut(s) 53
Eco81I CCTNAGG 1 cut(s) 173
EcoRII CCWGG 1 cut(s) 71
FaeI CATG 1 cut(s) 195
FaiI YATR 6 cut(s) 45, 51, 80, 145, 182, 193
FatI CATG 1 cut(s) 191
FspBI CTAG 1 cut(s) 57
Hin1II CATG 1 cut(s) 195
Hpy188III TCNNGA 3 cut(s) 38, 175, 192
HpyCH4V TGCA 3 cut(s) 4, 28, 137
HpyF3I CTNAG 3 cut(s) 119, 155, 173
Hsp92II CATG 1 cut(s) 195
LpnPI CCDG 5 cut(s) 51, 58, 81, 85, 160
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 158
MluCI AATT 1 cut(s) 185
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
NlaIII CATG 1 cut(s) 195
PagI TCATGA 1 cut(s) 191
Psp6I CCWGG 1 cut(s) 71
PspGI CCWGG 1 cut(s) 71
PspPI GGNCC 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 53
ScrFI CCNGG 1 cut(s) 73
SetI ASST 3 cut(s) 58, 88, 117
SgeI CNNG 9 cut(s) 17, 33, 50, 69, 80, 84, 85, 175, 187
SinI GGWCC 1 cut(s) 53
Sse9I AATT 1 cut(s) 185
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 1 cut(s) 71
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 53
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.