RchiOBHm_Chr5g0038911

BT1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
33666483 .. 33667489
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGATTGAAAGGCTGAAAAGATTAAGAGCTGCATTTGGAGCCTCATTTCTCTGGCTCGTTTGCCTCATTTACTTCACCCAGGGTTTTAGATACTTTGTTTGGACTGCAGTTTCTTACCAGCTGAAAGATAGGCTCAAGTTGTCACCGTCGTCTTCCCAGATTGTGTTTTCGATACCTTTCTTCCCATGGAGCATTAAACCATTATATGGGATCAACTGGATGGGTAGAAAAAAAACAGAGACATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BT1

Protein Analysis

82

Amino Acids

9.74

Weight (kDa)

10.18

Isoelectric Point (pI)

36.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BT1 PF03092 27 - 71 4.1e-07 BT1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 206
AclWI GGATC 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 206
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 2 cut(s) 29, 121
AluI AGCT 2 cut(s) 29, 121
Alw26I GTCTC 1 cut(s) 233
AlwI GGATC 1 cut(s) 218
ApeKI GCWGC 1 cut(s) 29
AsuHPI GGTGA 2 cut(s) 67, 135
BbsI GAAGAC 1 cut(s) 144
BbvI GCAGC 1 cut(s) 16
BccI CCATC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 233
BfaI CTAG 1 cut(s) 247
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 40
BmrFI CCNGG 1 cut(s) 80
BpiI GAAGAC 1 cut(s) 144
BpuEI CTTGAG 1 cut(s) 119
BsaJI CCNNGG 3 cut(s) 78, 79, 185
Bsc4I CCNNNNNNNGG 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 221
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 3 cut(s) 78, 79, 185
BseGI GGATG 1 cut(s) 225
BseLI CCNNNNNNNGG 1 cut(s) 206
BseNI ACTGG 1 cut(s) 221
BseXI GCAGC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 206
BsmAI GTCTC 1 cut(s) 233
Bsp143I GATC 1 cut(s) 210
Bsp19I CCATGG 1 cut(s) 185
BspLI GGNNCC 1 cut(s) 40
BspMAI CTGCAG 1 cut(s) 109
BspPI GGATC 1 cut(s) 218
BsrI ACTGG 1 cut(s) 221
BssECI CCNNGG 3 cut(s) 78, 79, 185
BssMI GATC 1 cut(s) 210
BssT1I CCWWGG 1 cut(s) 185
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 147
BstDSI CCRYGG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 225
BstKTI GATC 1 cut(s) 213
BstMAI GTCTC 1 cut(s) 233
BstMBI GATC 1 cut(s) 210
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 80
BstNSI RCATGY 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 225
CviAII CATG 2 cut(s) 186, 243
CviJI RGCY 6 cut(s) 13, 29, 41, 55, 121, 133
CviKI_1 RGCY 6 cut(s) 13, 29, 41, 55, 121, 133
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
Eco130I CCWWGG 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 185
ErhI CCWWGG 1 cut(s) 185
FaeI CATG 2 cut(s) 189, 246
FaiI YATR 4 cut(s) 187, 205, 207, 244
FatI CATG 2 cut(s) 185, 242
Fnu4HI GCNGC 1 cut(s) 30
FokI GGATG 1 cut(s) 232
Fsp4HI GCNGC 1 cut(s) 30
FspBI CTAG 1 cut(s) 247
GluI GCNGC 1 cut(s) 30
Hin1II CATG 2 cut(s) 189, 246
HphI GGTGA 2 cut(s) 67, 135
Hpy99I CGWCG 1 cut(s) 151
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 32, 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
Hsp92II CATG 2 cut(s) 189, 246
Kzo9I GATC 1 cut(s) 210
LmnI GCTCC 2 cut(s) 38, 189
LpnPI CCDG 6 cut(s) 37, 65, 92, 131, 170, 202
Lsp1109I GCAGC 1 cut(s) 16
MaeI CTAG 1 cut(s) 247
MaeIII GTNAC 1 cut(s) 141
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MboII GAAGA 2 cut(s) 144, 172
MnlI CCTC 2 cut(s) 52, 74
MseI TTAA 2 cut(s) 23, 195
MspA1I CMGCKG 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 38
NcoI CCATGG 1 cut(s) 185
NdeII GATC 1 cut(s) 210
NlaIII CATG 2 cut(s) 189, 246
NlaIV GGNNCC 1 cut(s) 40
NmuCI GTSAC 1 cut(s) 141
NspI RCATGY 1 cut(s) 246
PasI CCCWGGG 1 cut(s) 79
PflMI CCANNNNNTGG 1 cut(s) 206
PkrI GCNGC 1 cut(s) 31
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspN4I GGNNCC 1 cut(s) 40
PstI CTGCAG 1 cut(s) 109
PvuII CAGCTG 1 cut(s) 121
SaqAI TTAA 2 cut(s) 23, 195
SatI GCNGC 1 cut(s) 30
Sau3AI GATC 1 cut(s) 210
ScrFI CCNGG 1 cut(s) 80
SetI ASST 3 cut(s) 31, 123, 178
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 9 cut(s) 64, 68, 91, 92, 130, 148, 169, 198, 229
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 185
TaaI ACNGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 170
Tru1I TTAA 2 cut(s) 23, 195
Tru9I TTAA 2 cut(s) 23, 195
TseFI GTSAC 1 cut(s) 141
TseI GCWGC 1 cut(s) 29
Tsp45I GTSAC 1 cut(s) 141
Van91I CCANNNNNTGG 1 cut(s) 206
XceI RCATGY 1 cut(s) 246
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.