RchiOBHm_Chr5g0039031

60s ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
33765849 .. 33767634
1786 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGGCCTTGGCAAAGAAGACAATGAGTTGGTCAGGTTGAAGCTTGAAGCAAGGCTGAAAGGAGGATTCTATGTTGAGCCAGACTCTATGCTTTTGTTTATCATTCGTATCCGTGGACACCCCAACCTGAAGAGTGTGAAGGAATTGATTTACAAGAGGGGTTATGGCAAGTTGAACAAGCCGAGAATCGCTTTGACTACTGCAGTAAATTTATTAGCCAGATGGCAAATGGACTGTTTCGATTAG

Protein Analysis

81

Amino Acids

9.36

Weight (kDa)

9.77

Isoelectric Point (pI)

22.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 208
AcuI CTGAAG 1 cut(s) 149
AgsI TTSAA 3 cut(s) 40, 47, 175
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AoxI GGCC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 24
BccI CCATC 1 cut(s) 216
BciVI GTATCC 1 cut(s) 119
BfmI CTRYAG 1 cut(s) 201
BfuI GTATCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 24
BplI GAGNNNNNCTC 2 cut(s) 68, 100
BsaJI CCNNGG 2 cut(s) 7, 112
BseDI CCNNGG 2 cut(s) 7, 112
BshFI GGCC 1 cut(s) 6
BsnI GGCC 1 cut(s) 6
BspANI GGCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 205
BssECI CCNNGG 2 cut(s) 7, 112
BssT1I CCWWGG 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 236
Bst6I CTCTTC 1 cut(s) 125
BstDSI CCRYGG 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 201
BstV2I GAAGAC 1 cut(s) 24
BsuI GTATCC 1 cut(s) 119
BsuRI GGCC 1 cut(s) 6
BtgI CCRYGG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 6 cut(s) 6, 43, 55, 79, 181, 218
CviKI_1 RGCY 6 cut(s) 6, 43, 55, 79, 181, 218
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
Eco130I CCWWGG 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 149
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaiI YATR 3 cut(s) 72, 89, 165
HaeIII GGCC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 3 cut(s) 66, 83, 186
Hpy166II GTNNAC 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 236
HpyCH4V TGCA 1 cut(s) 203
LpnPI CCDG 4 cut(s) 19, 93, 140, 232
MboII GAAGA 2 cut(s) 29, 142
MluCI AATT 2 cut(s) 143, 208
MlyI GAGTC 1 cut(s) 77
MnlI CCTC 2 cut(s) 56, 150
NmeAIII GCCGAG 1 cut(s) 207
PfeI GAWTC 2 cut(s) 66, 186
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 205
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 77
SetI ASST 3 cut(s) 38, 45, 129
SfcI CTRYAG 1 cut(s) 201
Sse9I AATT 2 cut(s) 143, 208
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 236
TaqI TCGA 1 cut(s) 240
TasI AATT 2 cut(s) 143, 208
TfiI GAWTC 2 cut(s) 66, 186
TspGWI ACGGA 1 cut(s) 101
XapI RAATTY 1 cut(s) 208
XcmI CCANNNNNNNNNTGG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.