RchiOBHm_Chr5g0040491

At4g28440-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
35187547 .. 35187903
357 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTCGTCGACGACCACCAACAAAGCCAGACTACCATATGTCCAACAAGCCCTGCAGAGCAATGTGAAGCCAGTGTTCATCAAGGTCAACGATCTCAAGCCCAGATCGGTGTCTCAACACCTCCCCCAGACCCAAATCTCTGAGTCCCTCACTTGCAGAGTCCTTGCACTCGTCAATCTCCTCCGTTATCTGAGAAGAGTTTTCATCAATTTCCCTGAAAACAACAAATCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.84

Weight (kDa)

10.67

Isoelectric Point (pI)

64.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 117
BcoDI GTCTC 1 cut(s) 117
BfmI CTRYAG 1 cut(s) 53
BpuEI CTTGAG 1 cut(s) 80
Bse1I ACTGG 1 cut(s) 71
Bse3DI GCAATG 1 cut(s) 67
BseMI GCAATG 1 cut(s) 67
BseMII CTCAG 2 cut(s) 132, 182
BseNI ACTGG 1 cut(s) 71
BseRI GAGGAG 1 cut(s) 170
BslFI GGGAC 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 91, 104
BspCNI CTCAG 2 cut(s) 133, 183
BspMAI CTGCAG 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 67
BsrI ACTGG 1 cut(s) 71
BssMI GATC 2 cut(s) 91, 104
Bst6I CTCTTC 1 cut(s) 190
BstDEI CTNAG 2 cut(s) 141, 191
BstKTI GATC 2 cut(s) 94, 107
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 2 cut(s) 91, 104
BstSFI CTRYAG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 78
CviJI RGCY 4 cut(s) 26, 50, 70, 100
CviKI_1 RGCY 4 cut(s) 26, 50, 70, 100
DdeI CTNAG 2 cut(s) 141, 191
DpnI GATC 2 cut(s) 93, 106
DpnII GATC 2 cut(s) 91, 104
Eam1104I CTCTTC 1 cut(s) 190
EarI CTCTTC 1 cut(s) 190
FaiI YATR 2 cut(s) 37, 39
FaqI GGGAC 1 cut(s) 130
FauNDI CATATG 1 cut(s) 37
FblI GTMKAC 1 cut(s) 8
HincII GTYRAC 2 cut(s) 9, 88
HindII GTYRAC 2 cut(s) 9, 88
HinfI GANTC 2 cut(s) 143, 159
Hpy166II GTNNAC 2 cut(s) 9, 88
Hpy188I TCNGA 2 cut(s) 142, 192
Hpy188III TCNNGA 1 cut(s) 231
Hpy8I GTNNAC 2 cut(s) 9, 88
Hpy99I CGWCG 2 cut(s) 10, 13
HpyCH4V TGCA 3 cut(s) 55, 156, 167
HpyF3I CTNAG 2 cut(s) 141, 191
Kzo9I GATC 2 cut(s) 91, 104
LpnPI CCDG 6 cut(s) 40, 65, 84, 115, 140, 228
MalI GATC 2 cut(s) 93, 106
MboI GATC 2 cut(s) 91, 104
MboII GAAGA 1 cut(s) 207
MluCI AATT 1 cut(s) 208
MlyI GAGTC 2 cut(s) 152, 168
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 3 cut(s) 131, 158, 191
NdeI CATATG 1 cut(s) 37
NdeII GATC 2 cut(s) 91, 104
PleI GAGTC 2 cut(s) 151, 167
PpsI GAGTC 2 cut(s) 151, 167
PstI CTGCAG 1 cut(s) 57
SalI GTCGAC 1 cut(s) 7
Sau3AI GATC 2 cut(s) 91, 104
SchI GAGTC 2 cut(s) 152, 168
SetI ASST 2 cut(s) 87, 123
SfcI CTRYAG 1 cut(s) 53
SgrDI CGTCGACG 1 cut(s) 7
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 1 cut(s) 208
TaqI TCGA 1 cut(s) 8
TasI AATT 1 cut(s) 208
TscAI CASTG 1 cut(s) 78
TspDTI ATGAA 2 cut(s) 67, 193
TspGWI ACGGA 1 cut(s) 173
TspRI CASTG 1 cut(s) 78
XmiI GTMKAC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.