RchiOBHm_Chr5g0042171

Transcription initiation factor TFIID subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
36965786 .. 36966307
522 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGAGCAACGTGCCTAAAGAAGCAATTGAGGTCGTAGCACAGAGCATTGGCATTACCAATTTGTCTCCTGATGTTGCACTTGCTCTCACCCCAGATATCGAGTACCGGATTCGCGAGATCATGCAGGTATGCCCATGTTGTTGTGGTTATATGATAAGTTTTTGTTTCTTAATTTTGTGA

Protein Analysis

59

Amino Acids

6.52

Weight (kDa)

4.36

Isoelectric Point (pI)

52.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAF PF02969 1 - 42 2.3e-16 TATA box binding protein associated factor (TAF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 115
AccII CGCG 1 cut(s) 114
AfaI GTAC 1 cut(s) 104
Alw26I GTCTC 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 69
BfuAI ACCTGC 1 cut(s) 115
BsaWI WCCGGW 1 cut(s) 105
Bsh1236I CGCG 1 cut(s) 114
BsiSI CCGG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 69
Bsp143I GATC 1 cut(s) 117
Bsp68I TCGCGA 1 cut(s) 114
BspFNI CGCG 1 cut(s) 114
BspMI ACCTGC 1 cut(s) 115
BssMI GATC 1 cut(s) 117
BstFNI CGCG 1 cut(s) 114
BstKTI GATC 1 cut(s) 120
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 1 cut(s) 117
BstUI CGCG 1 cut(s) 114
BtuMI TCGCGA 1 cut(s) 114
BveI ACCTGC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 121, 135
CviQI GTAC 1 cut(s) 103
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eco32I GATATC 1 cut(s) 97
EcoRV GATATC 1 cut(s) 97
FaeI CATG 2 cut(s) 124, 138
FaiI YATR 5 cut(s) 122, 130, 136, 150, 152
FatI CATG 2 cut(s) 120, 134
HapII CCGG 1 cut(s) 106
Hin1II CATG 2 cut(s) 124, 138
HinfI GANTC 1 cut(s) 109
HpaII CCGG 1 cut(s) 106
HphI GGTGA 1 cut(s) 79
Hpy188III TCNNGA 2 cut(s) 68, 113
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 2 cut(s) 77, 124
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 2 cut(s) 124, 138
Kzo9I GATC 1 cut(s) 117
LpnPI CCDG 4 cut(s) 81, 105, 110, 119
MaeII ACGT 1 cut(s) 9
MalI GATC 1 cut(s) 119
MboI GATC 1 cut(s) 117
MfeI CAATTG 1 cut(s) 24
MluCI AATT 3 cut(s) 24, 58, 171
MnlI CCTC 1 cut(s) 22
MseI TTAA 1 cut(s) 170
MspI CCGG 1 cut(s) 106
MunI CAATTG 1 cut(s) 24
MvnI CGCG 1 cut(s) 114
NdeII GATC 1 cut(s) 117
NlaIII CATG 2 cut(s) 124, 138
NruI TCGCGA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 109
RruI TCGCGA 1 cut(s) 114
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
SaqAI TTAA 1 cut(s) 170
Sau3AI GATC 1 cut(s) 117
SetI ASST 3 cut(s) 12, 33, 129
Sse9I AATT 3 cut(s) 24, 58, 171
TaiI ACGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 99
TasI AATT 3 cut(s) 24, 58, 171
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.