RchiOBHm_Chr5g0042291

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
37057733 .. 37058331
599 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 147 bp
ATGCTACCTAGGCATGCTCGGCTTCAAAATATGACATACTCAGCCAAGATCAAAGTGAACGTTACTGTTGAGGTATATACTCAAAATCTTGTCAGAAGTGAAAAGTTTAAACTGGTAAAGAACAATGTCTTGACAAGCAGATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component

Protein Analysis

48

Amino Acids

5.63

Weight (kDa)

10.69

Isoelectric Point (pI)

22.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 60
AgsI TTSAA 1 cut(s) 26
AspA2I CCTAGG 1 cut(s) 8
AvrII CCTAGG 1 cut(s) 8
BfaI CTAG 1 cut(s) 9
BlnI CCTAGG 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 8
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 117
Bsp143I GATC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 53
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 40
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstMWI GCNNNNNNNGC 2 cut(s) 10, 19
BstNSI RCATGY 1 cut(s) 17
Cac8I GCNNGC 1 cut(s) 15
CviAII CATG 1 cut(s) 14
CviJI RGCY 2 cut(s) 22, 44
CviKI_1 RGCY 2 cut(s) 22, 44
DdeI CTNAG 1 cut(s) 40
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DraI TTTAAA 1 cut(s) 109
Eco130I CCWWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 1 cut(s) 17
FaiI YATR 5 cut(s) 15, 32, 37, 76, 78
FatI CATG 1 cut(s) 13
FspBI CTAG 1 cut(s) 9
FspEI CC 5 cut(s) 4, 21, 56, 58, 98
Hin1II CATG 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 95
Hpy188III TCNNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 60
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 19
HpyF3I CTNAG 1 cut(s) 40
HpySE526I ACGT 1 cut(s) 60
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 1 cut(s) 98
MaeI CTAG 1 cut(s) 9
MaeII ACGT 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 61
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MnlI CCTC 1 cut(s) 64
MseI TTAA 1 cut(s) 108
MssI GTTTAAAC 1 cut(s) 109
MwoI GCNNNNNNNGC 2 cut(s) 10, 19
NdeII GATC 1 cut(s) 48
NlaIII CATG 1 cut(s) 17
NspI RCATGY 1 cut(s) 17
PaeI GCATGC 1 cut(s) 17
PmeI GTTTAAAC 1 cut(s) 109
Psp1406I AACGTT 1 cut(s) 60
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 1 cut(s) 48
SetI ASST 3 cut(s) 10, 63, 75
SgeI CNNG 7 cut(s) 21, 26, 30, 58, 101, 125, 142
SphI GCATGC 1 cut(s) 17
SspMI CTAG 1 cut(s) 9
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 1 cut(s) 63
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
XceI RCATGY 1 cut(s) 17
XmaJI CCTAGG 1 cut(s) 8
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.