RchiOBHm_Chr5g0044041

Aspartokinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
39151851 .. 39156392
4542 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGACACTGATGGGTGAACGACTAGACACTGACCTTTTGACATTAAAAACCTTTTTTGACAAAAAGATCCAACAACTACAACTCCATACCATCCTCCTTCTGAGAGAGAAAGAGTCATCGAAGCAAGTAGAAGAGAATTATTCATCTCTGAACCAGACAAAAAAGCCAAGAGACTTGGGGATATGGGTGGATGTCTTTGCTACTAGTGAAGTCAGCATTTGCTTGAGGTTGGACCCATCAAAACTTTGGAGCAGATAG

Protein Analysis

85

Amino Acids

9.97

Weight (kDa)

7.87

Isoelectric Point (pI)

35.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AhlI ACTAGT 1 cut(s) 203
Alw26I GTCTC 1 cut(s) 165
AlwI GGATC 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 1 cut(s) 26
AvaII GGWCC 1 cut(s) 232
BccI CCATC 3 cut(s) 4, 98, 244
BcoDI GTCTC 1 cut(s) 165
BcuI ACTAGT 1 cut(s) 203
BfaI CTAG 2 cut(s) 23, 204
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 244
BsaXI ACNNNNNCTCC 2 cut(s) 66, 96
BseGI GGATG 2 cut(s) 90, 196
BseMII CTCAG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 234
BspPI GGATC 1 cut(s) 61
BssMI GATC 1 cut(s) 66
Bst6I CTCTTC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 2 cut(s) 90, 196
BstKTI GATC 1 cut(s) 69
BstMAI GTCTC 1 cut(s) 165
BstMBI GATC 1 cut(s) 66
BstX2I RGATCY 1 cut(s) 66
BstYI RGATCY 1 cut(s) 66
BtsCI GGATG 2 cut(s) 90, 196
BtsIMutI CAGTG 2 cut(s) 5, 27
Cfr13I GGNCC 1 cut(s) 232
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 232
FaiI YATR 2 cut(s) 87, 184
FokI GGATG 2 cut(s) 77, 203
FspBI CTAG 2 cut(s) 23, 204
HinfI GANTC 1 cut(s) 113
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 2 cut(s) 102, 150
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 249
LpnPI CCDG 1 cut(s) 167
MaeI CTAG 2 cut(s) 23, 204
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MboII GAAGA 1 cut(s) 143
MflI RGATCY 1 cut(s) 66
MluCI AATT 1 cut(s) 136
MlyI GAGTC 1 cut(s) 122
MmeI TCCRAC 2 cut(s) 94, 210
MnlI CCTC 2 cut(s) 104, 219
MseI TTAA 1 cut(s) 44
NdeII GATC 1 cut(s) 66
NlaIV GGNNCC 1 cut(s) 234
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PsuI RGATCY 1 cut(s) 66
SaqAI TTAA 1 cut(s) 44
Sau3AI GATC 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 1 cut(s) 122
SetI ASST 3 cut(s) 36, 53, 230
SgeI CNNG 7 cut(s) 35, 137, 166, 180, 187, 216, 235
SinI GGWCC 1 cut(s) 232
SmlI CTYRAG 1 cut(s) 223
SmoI CTYRAG 1 cut(s) 223
SpeI ACTAGT 1 cut(s) 203
Sse9I AATT 1 cut(s) 136
SspMI CTAG 2 cut(s) 23, 204
TaqI TCGA 1 cut(s) 119
TasI AATT 1 cut(s) 136
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
TscAI CASTG 2 cut(s) 12, 34
TspDTI ATGAA 1 cut(s) 132
TspRI CASTG 2 cut(s) 12, 34
VpaK11BI GGWCC 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 1 cut(s) 243
XspI CTAG 2 cut(s) 23, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.