RchiOBHm_Chr5g0050281

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
50309495 .. 50309894
400 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGGTGAGGGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGATAAGCGTCAGGTGATGATCAGGCTGTCATCCAAAGTGATCATCAAGCTCCTTATTGTCATGCAGAAGAATGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAAGTCTGGTAAAATTATGGTCGAACTAAATGGTAGGCTTAACAAGAGATTGAAGGTTGAAGGTTGGGCAACCAGGTTGCTTCTTTCAAGACAGTTTAGATATATCGTGCTCACCACTTCTGCTGGCATCATGGACCATGAAGAGGCTAGAAGAAAGAATGTCGGTGGGAAAGTTCTTGGTTTCTTTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

13.82

Weight (kDa)

10.14

Isoelectric Point (pI)

23.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 119 7.2e-17 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 310
AgsI TTSAA 3 cut(s) 220, 227, 255
AhdI GACNNNNNGTC 1 cut(s) 169
AjnI CCWGG 1 cut(s) 239
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw21I GWGCWC 1 cut(s) 279
AspS9I GGNCC 1 cut(s) 301
AsuHPI GGTGA 3 cut(s) 16, 85, 271
AvaII GGWCC 1 cut(s) 301
BarI GAAGNNNNNNTAC 2 cut(s) 119, 151
Bbv12I GWGCWC 1 cut(s) 279
BciT130I CCWGG 1 cut(s) 241
BciVI GTATCC 1 cut(s) 128
BclI TGATCA 2 cut(s) 78, 99
BfaI CTAG 1 cut(s) 315
BfuI GTATCC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 301
BmeRI GACNNNNNGTC 1 cut(s) 169
BmgT120I GGNCC 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 241
BmsI GCATC 2 cut(s) 16, 303
BpuEI CTTGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 310
BseBI CCWGG 1 cut(s) 241
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 310
BsiHKAI GWGCWC 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 310
Bsp1286I GDGCHC 1 cut(s) 279
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 99
BsrGI TGTACA 1 cut(s) 42
BssMI GATC 2 cut(s) 78, 99
Bst2UI CCWGG 1 cut(s) 241
Bst4CI ACNGT 1 cut(s) 261
Bst6I CTCTTC 1 cut(s) 303
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 17, 292
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 2 cut(s) 81, 102
BstMBI GATC 2 cut(s) 78, 99
BstNI CCWGG 1 cut(s) 241
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 239
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 2 cut(s) 17, 292
Cfr13I GGNCC 1 cut(s) 301
CseI GACGC 1 cut(s) 56
CsiI ACCWGGT 1 cut(s) 239
Csp6I GTAC 1 cut(s) 43
CviAII CATG 4 cut(s) 40, 121, 298, 305
CviJI RGCY 4 cut(s) 85, 109, 205, 314
CviKI_1 RGCY 4 cut(s) 85, 109, 205, 314
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 101
DpnII GATC 2 cut(s) 78, 99
DriI GACNNNNNGTC 1 cut(s) 169
Eam1104I CTCTTC 1 cut(s) 303
Eam1105I GACNNNNNGTC 1 cut(s) 169
EarI CTCTTC 1 cut(s) 303
Eco47I GGWCC 1 cut(s) 301
EcoRII CCWGG 1 cut(s) 239
FaeI CATG 4 cut(s) 43, 124, 301, 308
FaiI YATR 7 cut(s) 41, 122, 156, 185, 270, 299, 306
FatI CATG 4 cut(s) 39, 120, 297, 304
FbaI TGATCA 2 cut(s) 78, 99
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 315
HgaI GACGC 1 cut(s) 56
Hin1II CATG 4 cut(s) 43, 124, 301, 308
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HphI GGTGA 3 cut(s) 16, 85, 271
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 34, 255
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 2 cut(s) 214, 221
HpyCH4III ACNGT 1 cut(s) 261
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 50, 124
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 4 cut(s) 43, 124, 301, 308
Ksp22I TGATCA 2 cut(s) 78, 99
Kzo9I GATC 2 cut(s) 78, 99
LmnI GCTCC 1 cut(s) 114
LpnPI CCDG 6 cut(s) 56, 67, 159, 226, 253, 276
LweI GCATC 2 cut(s) 16, 303
MabI ACCWGGT 1 cut(s) 239
MaeI CTAG 1 cut(s) 315
MaeII ACGT 1 cut(s) 58
MalI GATC 2 cut(s) 80, 101
MboI GATC 2 cut(s) 78, 99
MboII GAAGA 3 cut(s) 139, 320, 330
MhlI GDGCHC 1 cut(s) 279
MluCI AATT 1 cut(s) 180
MnlI CCTC 1 cut(s) 304
MseI TTAA 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 241
MvaI CCWGG 1 cut(s) 241
NdeII GATC 2 cut(s) 78, 99
NlaIII CATG 4 cut(s) 43, 124, 301, 308
NspI RCATGY 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 64
Psp6I CCWGG 1 cut(s) 239
PspGI CCWGG 1 cut(s) 239
PspPI GGNCC 1 cut(s) 301
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 2 cut(s) 78, 99
Sau96I GGNCC 1 cut(s) 301
ScrFI CCNGG 1 cut(s) 241
SduI GDGCHC 1 cut(s) 279
SetI ASST 6 cut(s) 61, 75, 111, 225, 232, 245
SexAI ACCWGGT 1 cut(s) 239
SfaNI GCATC 2 cut(s) 16, 303
SinI GGWCC 1 cut(s) 301
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 180
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 1 cut(s) 239
TaaI ACNGT 1 cut(s) 261
TaiI ACGT 1 cut(s) 61
TaqI TCGA 2 cut(s) 150, 189
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 321
VpaK11BI GGWCC 1 cut(s) 301
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.