RchiOBHm_Chr5g0056291

Vacuolar protein sorting-associated protein 41 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
59878191 .. 59878671
481 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGCAGACTATGATTCAAAGATGCTGCTTCCTTTTCTTCGTAGTAGTCAACATTATACACTCGAGAAATGAAATTTGCATCAGAAATGATCTTGTAAAGGAGCAAGTTTTCATTCTTGGAAGAATGGAAAATGCAAAACAAACCCTTGCTATAATCATTAATAAACTAGGGGACATTGAAGGGGTATCGCTTGTTTATCGGATATCTGCATTAAACCTAAACAGATTCTTCAGTTATTTCTTGCCTGTTGTAGAATTTGTGAGTATGCAACATGATGATGAACTATGGGAGGAATTGATCCAGCAGTGTCTTCATAACCTGAGATGGTATTTATATTAG

Protein Analysis

112

Amino Acids

13.4

Weight (kDa)

5.86

Isoelectric Point (pI)

47.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_Vps41 PF23556 21 - 61 3.5e-10 Vps41 TPR-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 292
AcsI RAATTY 2 cut(s) 72, 254
AcuI CTGAAG 1 cut(s) 214
AgsI TTSAA 2 cut(s) 17, 179
AlwI GGATC 1 cut(s) 292
Ama87I CYCGRG 1 cut(s) 61
ApeKI GCWGC 1 cut(s) 24
ApoI RAATTY 2 cut(s) 72, 254
AseI ATTAAT 1 cut(s) 159
AvaI CYCGRG 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 302
BbvI GCAGC 1 cut(s) 11
BccI CCATC 1 cut(s) 318
BfaI CTAG 1 cut(s) 167
BisI GCNGC 1 cut(s) 25
BlsI GCNGC 1 cut(s) 26
BmeT110I CYCGRG 1 cut(s) 61
BmsI GCATC 2 cut(s) 11, 87
BpiI GAAGAC 1 cut(s) 302
BseMII CTCAG 1 cut(s) 311
BseXI GCAGC 1 cut(s) 11
BsiHKCI CYCGRG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 185
BsmFI GGGAC 1 cut(s) 185
BsoBI CYCGRG 1 cut(s) 61
Bsp143I GATC 2 cut(s) 88, 297
BspCNI CTCAG 1 cut(s) 312
BspPI GGATC 1 cut(s) 292
BssMI GATC 2 cut(s) 88, 297
BstDEI CTNAG 1 cut(s) 320
BstKTI GATC 2 cut(s) 91, 300
BstMBI GATC 2 cut(s) 88, 297
BstV1I GCAGC 1 cut(s) 11
BstV2I GAAGAC 1 cut(s) 302
BtsI GCAGTG 1 cut(s) 311
BtsIMutI CAGTG 1 cut(s) 311
CviAII CATG 1 cut(s) 272
DdeI CTNAG 1 cut(s) 320
DpnI GATC 2 cut(s) 90, 299
DpnII GATC 2 cut(s) 88, 297
Eco32I GATATC 1 cut(s) 204
Eco57I CTGAAG 1 cut(s) 214
Eco88I CYCGRG 1 cut(s) 61
EcoRV GATATC 1 cut(s) 204
FaeI CATG 1 cut(s) 275
FaiI YATR 8 cut(s) 11, 56, 152, 266, 273, 286, 315, 334
FaqI GGGAC 1 cut(s) 185
FatI CATG 1 cut(s) 271
Fnu4HI GCNGC 1 cut(s) 25
Fsp4HI GCNGC 1 cut(s) 25
FspBI CTAG 1 cut(s) 167
GluI GCNGC 1 cut(s) 25
Hin1II CATG 1 cut(s) 275
HincII GTYRAC 1 cut(s) 49
HindII GTYRAC 1 cut(s) 49
HinfI GANTC 2 cut(s) 13, 225
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 2 cut(s) 83, 201
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 49
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 5 cut(s) 4, 78, 134, 209, 268
HpyF3I CTNAG 1 cut(s) 320
Hsp92II CATG 1 cut(s) 275
Kzo9I GATC 2 cut(s) 88, 297
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 3 cut(s) 258, 314, 332
Lsp1109I GCAGC 1 cut(s) 11
LweI GCATC 2 cut(s) 11, 87
MaeI CTAG 1 cut(s) 167
MalI GATC 2 cut(s) 90, 299
MboI GATC 2 cut(s) 88, 297
MboII GAAGA 4 cut(s) 28, 132, 220, 302
MluCI AATT 3 cut(s) 72, 254, 293
MnlI CCTC 1 cut(s) 283
MseI TTAA 2 cut(s) 159, 212
MslI CAYNNNNRTG 1 cut(s) 276
NdeII GATC 2 cut(s) 88, 297
NlaIII CATG 1 cut(s) 275
PaeR7I CTCGAG 1 cut(s) 61
PfeI GAWTC 2 cut(s) 13, 225
PkrI GCNGC 1 cut(s) 26
PshBI ATTAAT 1 cut(s) 159
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 2 cut(s) 159, 212
SatI GCNGC 1 cut(s) 25
Sau3AI GATC 2 cut(s) 88, 297
SetI ASST 2 cut(s) 219, 321
SfaNI GCATC 2 cut(s) 11, 87
Sfr274I CTCGAG 1 cut(s) 61
SlaI CTCGAG 1 cut(s) 61
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 3 cut(s) 72, 254, 293
SspMI CTAG 1 cut(s) 167
TaqI TCGA 1 cut(s) 62
TasI AATT 3 cut(s) 72, 254, 293
TfiI GAWTC 2 cut(s) 13, 225
Tru1I TTAA 2 cut(s) 159, 212
Tru9I TTAA 2 cut(s) 159, 212
TscAI CASTG 1 cut(s) 311
TseI GCWGC 1 cut(s) 24
TspDTI ATGAA 4 cut(s) 84, 100, 294, 302
TspRI CASTG 1 cut(s) 311
VspI ATTAAT 1 cut(s) 159
XapI RAATTY 2 cut(s) 72, 254
XhoI CTCGAG 1 cut(s) 61
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.