RchiOBHm_Chr5g0062961

Converts zeaxanthin into antheraxanthin and subsequently violaxanthin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
68751076 .. 68751720
645 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 147 bp
ATGAAGTTTAGGATACCACATCCAAGAAGAGTTGGTGGGAGAGTTTTTATTGACAAGGCAATGCCCTTGAAACTGAGTTGGATCTTAGGTGGTAACAGCTCAAAACTTGAAGGAAGGCCACCAAGTTGCAGGCTTCACAGTGACTAA
Functional Annotation

Protein Analysis

48

Amino Acids

5.44

Weight (kDa)

11.38

Isoelectric Point (pI)

49.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 89
AgsI TTSAA 2 cut(s) 70, 110
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
AlwI GGATC 1 cut(s) 89
AoxI GGCC 1 cut(s) 116
BciVI GTATCC 1 cut(s) 6
BfuI GTATCC 1 cut(s) 6
Bse3DI GCAATG 1 cut(s) 66
BseGI GGATG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 118
BsnI GGCC 1 cut(s) 118
Bsp143I GATC 1 cut(s) 81
BspANI GGCC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 66
BspPI GGATC 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 66
BssMI GATC 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 140
Bst6I CTCTTC 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 74, 85
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 81
BstYI RGATCY 1 cut(s) 81
BsuI GTATCC 1 cut(s) 6
BsuRI GGCC 1 cut(s) 118
BtsCI GGATG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 131
CviJI RGCY 3 cut(s) 99, 118, 133
CviKI_1 RGCY 3 cut(s) 99, 118, 133
DdeI CTNAG 2 cut(s) 74, 85
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 22
EarI CTCTTC 1 cut(s) 22
FokI GGATG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 118
HpyAV CCTTC 2 cut(s) 104, 108
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 2 cut(s) 74, 85
Kzo9I GATC 1 cut(s) 81
LpnPI CCDG 1 cut(s) 115
MaeIII GTNAC 2 cut(s) 92, 140
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MboII GAAGA 1 cut(s) 39
MflI RGATCY 1 cut(s) 81
MmeI TCCRAC 1 cut(s) 59
NdeII GATC 1 cut(s) 81
NmuCI GTSAC 1 cut(s) 140
PsuI RGATCY 1 cut(s) 81
Sau3AI GATC 1 cut(s) 81
SetI ASST 2 cut(s) 91, 101
SgeI CNNG 6 cut(s) 36, 67, 79, 119, 135, 142
TaaI ACNGT 1 cut(s) 140
TscAI CASTG 1 cut(s) 145
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.