RchiOBHm_Chr5g0063951
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
69751789 .. 69751974
186 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGTTGTTGGGTACATTTGAGCTTTCAGGATTCCATCCTGCTCCTAGGGCTTTACTTCAGATTAATGTTAGCTTTAAGATCGAGGTCAATGGAATTTTGAATGTCTCTGCAGAGGAAAAGCTATCAAGTAAGAAAAATAACATCACAATCAAATATAACAAGGGTGGGCAACCCAATCAAAATTAA
Functional Annotation

Protein Analysis

61

Amino Acids

6.71

Weight (kDa)

9.6

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 2 - 57 2.6e-13 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 41
AfaI GTAC 1 cut(s) 13
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 3 cut(s) 22, 72, 121
AluI AGCT 3 cut(s) 22, 72, 121
Alw26I GTCTC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 93
AseI ATTAAT 1 cut(s) 63
AspA2I CCTAGG 1 cut(s) 44
AvrII CCTAGG 1 cut(s) 44
BccI CCATC 1 cut(s) 42
BcoDI GTCTC 1 cut(s) 109
BfaI CTAG 1 cut(s) 45
BfmI CTRYAG 1 cut(s) 108
BlnI CCTAGG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 44
BseGI GGATG 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 78
BspMAI CTGCAG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 1 cut(s) 78
BssT1I CCWWGG 1 cut(s) 44
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 109
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 108
BtsCI GGATG 1 cut(s) 34
Csp6I GTAC 1 cut(s) 12
CviJI RGCY 4 cut(s) 22, 50, 72, 121
CviKI_1 RGCY 4 cut(s) 22, 50, 72, 121
CviQI GTAC 1 cut(s) 12
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaiI YATR 1 cut(s) 156
FokI GGATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 45
HinfI GANTC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 110
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 12, 51
MaeI CTAG 1 cut(s) 45
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MluCI AATT 2 cut(s) 93, 181
MnlI CCTC 2 cut(s) 76, 106
MseI TTAA 3 cut(s) 63, 75, 184
MwoI GCNNNNNNNGC 1 cut(s) 47
NdeII GATC 1 cut(s) 78
PfeI GAWTC 1 cut(s) 30
PshBI ATTAAT 1 cut(s) 63
PstI CTGCAG 1 cut(s) 112
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SaqAI TTAA 3 cut(s) 63, 75, 184
Sau3AI GATC 1 cut(s) 78
SetI ASST 4 cut(s) 24, 74, 87, 123
SfcI CTRYAG 1 cut(s) 108
SgeI CNNG 6 cut(s) 39, 50, 57, 94, 138, 172
Sse9I AATT 2 cut(s) 93, 181
SspMI CTAG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 44
TaqI TCGA 1 cut(s) 81
TasI AATT 2 cut(s) 93, 181
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 3 cut(s) 63, 75, 184
Tru9I TTAA 3 cut(s) 63, 75, 184
VspI ATTAAT 1 cut(s) 63
XapI RAATTY 1 cut(s) 93
XmaJI CCTAGG 1 cut(s) 44
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.