RchiOBHm_Chr5g0067701

The light-harvesting complex (LHC) functions as a light receptor, it captures and delivers excitation energy to photosystems with which it is closely associated

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
73843451 .. 73843624
174 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGAGCAAGTTCAAAAAGGAGCTAAAGAATGGGCCATGTTTTCTATGTTCGGATTTTTCGTGCAAGCCAATTGTCACCGGAAATGGACCAATAGAAAACCTCGCCGATCACTTGGCTGACCCTGTTAACAACAATGCTTGGTCATATGCCACCAACTTTGTTCCCGGAAAGTGA

Protein Analysis

57

Amino Acids

6.23

Weight (kDa)

7.71

Isoelectric Point (pI)

12.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 2 cut(s) 32, 86
AsuC2I CCSGG 1 cut(s) 165
AsuHPI GGTGA 1 cut(s) 67
AvaII GGWCC 1 cut(s) 86
BcnI CCSGG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 2 cut(s) 32, 86
BmrFI CCNGG 1 cut(s) 165
BpuMI CCSGG 1 cut(s) 165
BsaWI WCCGGW 1 cut(s) 77
BshFI GGCC 1 cut(s) 34
BsiSI CCGG 2 cut(s) 78, 165
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 106
BspANI GGCC 1 cut(s) 34
BssMI GATC 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 65
BstKTI GATC 1 cut(s) 109
BstMBI GATC 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 163
BsuRI GGCC 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 65
Cfr13I GGNCC 2 cut(s) 32, 86
CspCI CAANNNNNGTGG 2 cut(s) 139, 174
CviAII CATG 1 cut(s) 36
CviJI RGCY 4 cut(s) 22, 34, 67, 116
CviKI_1 RGCY 4 cut(s) 22, 34, 67, 116
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco47I GGWCC 1 cut(s) 86
FaeI CATG 1 cut(s) 39
FaiI YATR 4 cut(s) 37, 46, 145, 147
FatI CATG 1 cut(s) 35
FauNDI CATATG 1 cut(s) 145
HaeIII GGCC 1 cut(s) 34
HapII CCGG 2 cut(s) 78, 165
Hin1II CATG 1 cut(s) 39
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HpaI GTTAAC 1 cut(s) 127
HpaII CCGG 2 cut(s) 78, 165
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 63
Hsp92II CATG 1 cut(s) 39
KspAI GTTAAC 1 cut(s) 127
Kzo9I GATC 1 cut(s) 106
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 2 cut(s) 91, 135
MaeIII GTNAC 1 cut(s) 73
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MfeI CAATTG 1 cut(s) 69
MluCI AATT 1 cut(s) 69
MnlI CCTC 1 cut(s) 110
MseI TTAA 1 cut(s) 126
MspI CCGG 2 cut(s) 78, 165
MspR9I CCNGG 1 cut(s) 165
MunI CAATTG 1 cut(s) 69
NciI CCSGG 1 cut(s) 165
NdeI CATATG 1 cut(s) 145
NdeII GATC 1 cut(s) 106
NlaIII CATG 1 cut(s) 39
NmuCI GTSAC 1 cut(s) 73
PcsI WCGNNNNNNNCGW 1 cut(s) 56
PfoI TCCNGGA 1 cut(s) 163
PspPI GGNCC 2 cut(s) 32, 86
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 2 cut(s) 32, 86
ScrFI CCNGG 1 cut(s) 165
SetI ASST 2 cut(s) 24, 102
SgeI CNNG 9 cut(s) 19, 48, 72, 76, 90, 113, 124, 134, 150
SinI GGWCC 1 cut(s) 86
Sse9I AATT 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 163
TasI AATT 1 cut(s) 69
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.