RchiOBHm_Chr5g0073731

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Forward (+)
79777295 .. 79780063
2769 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGATAACCCTTGAACAAAAGAAAATTGCAAAGAGAAGACTAATTCTTGCCAAACGGCTCCTTGTCTATGAGTATCTGGAGAATAAGAGTCTTGATCAAGCATTATTTGGTATGAGAATACCATTATCAATTTATTTCTTCTAG

Protein Analysis

47

Amino Acids

5.68

Weight (kDa)

9.99

Isoelectric Point (pI)

41.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 14
BbsI GAAGAC 1 cut(s) 43
BceAI ACGGC 1 cut(s) 71
BclI TGATCA 1 cut(s) 94
BfaI CTAG 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 59
BpiI GAAGAC 1 cut(s) 43
BpmI CTGGAG 1 cut(s) 98
Bsp143I GATC 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 59
BssMI GATC 1 cut(s) 94
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 43
CviJI RGCY 1 cut(s) 58
CviKI_1 RGCY 1 cut(s) 58
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
FaiI YATR 2 cut(s) 69, 113
FbaI TGATCA 1 cut(s) 94
FspBI CTAG 1 cut(s) 142
FspEI CC 8 cut(s) 22, 23, 40, 62, 64, 74, 93, 135
GsuI CTGGAG 1 cut(s) 98
HinfI GANTC 1 cut(s) 88
Hpy188III TCNNGA 2 cut(s) 77, 92
HpyCH4V TGCA 1 cut(s) 29
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 1 cut(s) 62
MaeI CTAG 1 cut(s) 142
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 2 cut(s) 48, 130
MluCI AATT 3 cut(s) 24, 42, 129
MlyI GAGTC 1 cut(s) 97
NdeII GATC 1 cut(s) 94
NlaIV GGNNCC 1 cut(s) 59
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
PspN4I GGNNCC 1 cut(s) 59
Sau3AI GATC 1 cut(s) 94
SchI GAGTC 1 cut(s) 97
SgeI CNNG 6 cut(s) 23, 59, 74, 89, 104, 110
Sse9I AATT 3 cut(s) 24, 42, 129
SspMI CTAG 1 cut(s) 142
TasI AATT 3 cut(s) 24, 42, 129
XspI CTAG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.