RchiOBHm_Chr5g0077941

beta-glucosidase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
83800152 .. 83801864
1713 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGTCAACTTTACAGCCCATGCAAATTGATGTTGTTTTGTACTTTCAATACTGTCATTGCCCACTAGCGGACCCAGCTAAGGCCCAAAACCATTTCCAAGACTACGCAGACCTATACTTCAAGGAATTTGGTGATAGAGTTAAGGACTGTATCACATTAAATGAGCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.57

Weight (kDa)

4.64

Isoelectric Point (pI)

37.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AcsI RAATTY 1 cut(s) 125
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 2 cut(s) 67, 79
AgsI TTSAA 2 cut(s) 47, 121
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
AoxI GGCC 1 cut(s) 81
ApoI RAATTY 1 cut(s) 125
AspS9I GGNCC 2 cut(s) 70, 82
AsuHPI GGTGA 1 cut(s) 143
AvaII GGWCC 1 cut(s) 70
BanII GRGCYC 1 cut(s) 168
BfaI CTAG 2 cut(s) 65, 169
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 2 cut(s) 70, 82
BmiI GGNNCC 1 cut(s) 72
Bpu10I CCTNAGC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 2 cut(s) 67, 79
Bse3DI GCAATG 1 cut(s) 55
BseLI CCNNNNNNNGG 2 cut(s) 67, 79
BseMI GCAATG 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 73
BshFI GGCC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 67, 79
BsnI GGCC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 168
BspACI CCGC 1 cut(s) 68
BspANI GGCC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 55
Bst4CI ACNGT 2 cut(s) 53, 149
BstDEI CTNAG 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 74
BsuRI GGCC 1 cut(s) 83
Cfr13I GGNCC 2 cut(s) 70, 82
Csp6I GTAC 1 cut(s) 40
CviAII CATG 1 cut(s) 19
CviJI RGCY 4 cut(s) 16, 77, 83, 166
CviKI_1 RGCY 4 cut(s) 16, 77, 83, 166
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 78
Eco24I GRGCYC 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 70
EcoT38I GRGCYC 1 cut(s) 168
FaeI CATG 1 cut(s) 22
FaiI YATR 2 cut(s) 20, 115
FatI CATG 1 cut(s) 18
FriOI GRGCYC 1 cut(s) 168
FspBI CTAG 2 cut(s) 65, 169
GsaI CCCAGC 1 cut(s) 77
HaeIII GGCC 1 cut(s) 83
Hin1II CATG 1 cut(s) 22
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 6
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 2 cut(s) 53, 149
HpyCH4V TGCA 1 cut(s) 22
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 1 cut(s) 22
LpnPI CCDG 1 cut(s) 87
MaeI CTAG 2 cut(s) 65, 169
MhlI GDGCHC 1 cut(s) 168
MluCI AATT 2 cut(s) 24, 125
MseI TTAA 2 cut(s) 141, 158
MwoI GCNNNNNNNGC 1 cut(s) 74
NlaIII CATG 1 cut(s) 22
NlaIV GGNNCC 1 cut(s) 72
PspFI CCCAGC 1 cut(s) 73
PspN4I GGNNCC 1 cut(s) 72
PspPI GGNCC 2 cut(s) 70, 82
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 141, 158
Sau96I GGNCC 2 cut(s) 70, 82
SduI GDGCHC 1 cut(s) 168
SetI ASST 2 cut(s) 79, 114
SgeI CNNG 5 cut(s) 31, 77, 86, 110, 133
SinI GGWCC 1 cut(s) 70
Sse9I AATT 2 cut(s) 24, 125
SsiI CCGC 1 cut(s) 68
SspMI CTAG 2 cut(s) 65, 169
TaaI ACNGT 2 cut(s) 53, 149
TasI AATT 2 cut(s) 24, 125
TatI WGTACW 1 cut(s) 39
Tru1I TTAA 2 cut(s) 141, 158
Tru9I TTAA 2 cut(s) 141, 158
VpaK11BI GGWCC 1 cut(s) 70
XapI RAATTY 1 cut(s) 125
XspI CTAG 2 cut(s) 65, 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.