RchiOBHm_Chr5g0080991

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
87010798 .. 87012670
1873 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGGAAACTGTTCCGGGAGAGTTGGCACTCGGTTGAAAACACCTTTGTTTCCTGAAAACATCATACATAGCAGTTGTAAGAAGGTTCCTAATTCCATCAAAGAGATCAGGAAGTTTGCCCAGAAGGCAATGGGAACAAATGATGTCAGGGTGGATATGAAGTTGAACAAGCAATTCTGGGGCAGAGGAATCAGGAGTATTCCAAGAAGAATCAGGGTTCGCATTGCTCGCAAGACGAATGAATGA

Protein Analysis

81

Amino Acids

9.34

Weight (kDa)

11.62

Isoelectric Point (pI)

30.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L31e PF01198 27 - 81 4.5e-23 Ribosomal protein L31e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 37, 166
Asp700I GAANNNNTTC 1 cut(s) 10
AsuC2I CCSGG 1 cut(s) 16
BccI CCATC 1 cut(s) 104
BcnI CCSGG 1 cut(s) 16
BglI GCCNNNNNGGC 1 cut(s) 125
Bme1390I CCNGG 1 cut(s) 16
BmiI GGNNCC 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 16
BpuMI CCSGG 1 cut(s) 16
Bse3DI GCAATG 2 cut(s) 135, 222
BseMI GCAATG 2 cut(s) 135, 222
BsiSI CCGG 1 cut(s) 15
Bsp143I GATC 1 cut(s) 105
BspLI GGNNCC 1 cut(s) 87
BsrDI GCAATG 2 cut(s) 135, 222
BssMI GATC 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 229
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 2 cut(s) 125, 228
BstSCI CCNGG 1 cut(s) 14
Cac8I GCNNGC 1 cut(s) 229
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
FaiI YATR 3 cut(s) 65, 69, 158
HapII CCGG 1 cut(s) 15
HinfI GANTC 2 cut(s) 189, 210
HpaII CCGG 1 cut(s) 15
Hpy188III TCNNGA 3 cut(s) 53, 109, 193
HpyAV CCTTC 2 cut(s) 76, 118
HpyCH4III ACNGT 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 2 cut(s) 125, 228
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 8 cut(s) 28, 66, 94, 133, 134, 163, 178, 199
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 1 cut(s) 219
MluCI AATT 2 cut(s) 91, 173
MnlI CCTC 1 cut(s) 179
MroXI GAANNNNTTC 1 cut(s) 10
MspI CCGG 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 16
MwoI GCNNNNNNNGC 2 cut(s) 125, 228
NciI CCSGG 1 cut(s) 16
NdeII GATC 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 87
PdmI GAANNNNTTC 1 cut(s) 10
PfeI GAWTC 2 cut(s) 189, 210
PfoI TCCNGGA 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 87
Sau3AI GATC 1 cut(s) 105
ScrFI CCNGG 1 cut(s) 16
SetI ASST 2 cut(s) 46, 87
Sse9I AATT 2 cut(s) 91, 173
StyD4I CCNGG 1 cut(s) 14
TaaI ACNGT 1 cut(s) 11
TasI AATT 2 cut(s) 91, 173
TfiI GAWTC 2 cut(s) 189, 210
TspDTI ATGAA 1 cut(s) 173
XmnI GAANNNNTTC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.