RchiOBHm_Chr5g0081021

Protein trichome birefringence-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
87058830 .. 87059810
981 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGGCCTCCTTGTGCAGGATGAATGGAAGGAACATGTTGGGATTATTGAGAGGAAAGCGTCTAATTTTTTGTCTTCTTAGGAATTCAGTGGATGATAAGAGCAGAGTTTTTGAAGCTTCTGGCAGGAGTGAATTTTGTACAGAGGGCGCCTACTATTTTGTATTCAAGGATAACAATTATTCAGTGGAGTTTGTTCAATCACCATTTCTAGTTCCAGAATCGGAGGTGCTAACCATAAATGGGTCAAAGAAGGAAACACCGCCTGGATATGGTTCAGAGATCCTTGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PC-Esterase PMR5N

Protein Analysis

96

Amino Acids

10.78

Weight (kDa)

7.68

Isoelectric Point (pI)

53.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 146
AciI CCGC 1 cut(s) 260
AclWI GGATC 1 cut(s) 274
AcsI RAATTY 2 cut(s) 82, 131
AcyI GRCGYC 1 cut(s) 147
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 3 cut(s) 15, 240, 269
AflIII ACRYGT 1 cut(s) 33
AgsI TTSAA 3 cut(s) 113, 166, 197
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
AlwI GGATC 1 cut(s) 274
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 82, 131
AspLEI GCGC 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 192
BanI GGYRCC 1 cut(s) 146
BbsI GAAGAC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 264
BfaI CTAG 1 cut(s) 209
BfoI RGCGCY 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 264
BmiI GGNNCC 1 cut(s) 148
BmrFI CCNGG 1 cut(s) 264
BpiI GAAGAC 1 cut(s) 65
BsaHI GRCGYC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 283
Bsc4I CCNNNNNNNGG 3 cut(s) 15, 240, 269
BseBI CCWGG 1 cut(s) 264
BseDI CCNNGG 1 cut(s) 283
BseGI GGATG 2 cut(s) 24, 97
BseLI CCNNNNNNNGG 3 cut(s) 15, 240, 269
BsgI GTGCAG 1 cut(s) 34
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 146
BslI CCNNNNNNNGG 3 cut(s) 15, 240, 269
BsnI GGCC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 137
Bsp143I GATC 1 cut(s) 279
BspACI CCGC 1 cut(s) 260
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 148
BspPI GGATC 1 cut(s) 274
BspT107I GGYRCC 1 cut(s) 146
BsrGI TGTACA 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 283
BssMI GATC 1 cut(s) 279
BssNI GRCGYC 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 283
Bst2UI CCWGG 1 cut(s) 264
BstACI GRCGYC 1 cut(s) 147
BstAUI TGTACA 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 77
BstENI CCTNNNNNAGG 1 cut(s) 13
BstF5I GGATG 2 cut(s) 24, 97
BstH2I RGCGCY 1 cut(s) 150
BstHHI GCGC 1 cut(s) 149
BstKTI GATC 1 cut(s) 282
BstMBI GATC 1 cut(s) 279
BstNI CCWGG 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 262
BstV2I GAAGAC 1 cut(s) 65
BstX2I RGATCY 1 cut(s) 279
BstYI RGATCY 1 cut(s) 279
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 24, 97
BtsIMutI CAGTG 2 cut(s) 93, 189
CfoI GCGC 1 cut(s) 149
CseI GACGC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 138
CviAII CATG 1 cut(s) 34
CviJI RGCY 2 cut(s) 5, 116
CviKI_1 RGCY 2 cut(s) 5, 116
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 1 cut(s) 77
DinI GGCGCC 1 cut(s) 148
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
Eco130I CCWWGG 1 cut(s) 283
EcoNI CCTNNNNNAGG 1 cut(s) 13
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 262
EcoT14I CCWWGG 1 cut(s) 283
EgeI GGCGCC 1 cut(s) 148
EheI GGCGCC 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 283
FaeI CATG 1 cut(s) 37
FaiI YATR 3 cut(s) 35, 236, 270
FatI CATG 1 cut(s) 33
FokI GGATG 2 cut(s) 31, 104
FspBI CTAG 1 cut(s) 209
GlaI GCGC 1 cut(s) 148
HaeII RGCGCY 1 cut(s) 150
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 47
HhaI GCGC 1 cut(s) 149
Hin1I GRCGYC 1 cut(s) 147
Hin1II CATG 1 cut(s) 37
Hin6I GCGC 1 cut(s) 147
HinP1I GCGC 1 cut(s) 147
HindIII AAGCTT 1 cut(s) 114
HinfI GANTC 1 cut(s) 218
HphI GGTGA 1 cut(s) 192
Hpy188I TCNGA 2 cut(s) 223, 277
Hpy188III TCNNGA 1 cut(s) 215
HpyAV CCTTC 2 cut(s) 21, 244
HpyCH4V TGCA 1 cut(s) 15
HpyF3I CTNAG 1 cut(s) 77
Hsp92I GRCGYC 1 cut(s) 147
Hsp92II CATG 1 cut(s) 37
HspAI GCGC 1 cut(s) 147
KasI GGCGCC 1 cut(s) 146
Kzo9I GATC 1 cut(s) 279
LpnPI CCDG 5 cut(s) 105, 109, 228, 249, 276
MaeI CTAG 1 cut(s) 209
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MboII GAAGA 1 cut(s) 65
MflI RGATCY 1 cut(s) 279
MluCI AATT 4 cut(s) 63, 82, 131, 175
Mly113I GGCGCC 1 cut(s) 147
MnlI CCTC 4 cut(s) 16, 44, 136, 217
MspR9I CCNGG 1 cut(s) 264
MvaI CCWGG 1 cut(s) 264
NarI GGCGCC 1 cut(s) 147
NdeII GATC 1 cut(s) 279
NlaIII CATG 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 148
NspI RCATGY 1 cut(s) 37
PciI ACATGT 1 cut(s) 33
PfeI GAWTC 1 cut(s) 218
PluTI GGCGCC 1 cut(s) 150
PscI ACATGT 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
PspN4I GGNNCC 1 cut(s) 148
PsuI RGATCY 1 cut(s) 279
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
Sau3AI GATC 1 cut(s) 279
ScrFI CCNGG 1 cut(s) 264
SetI ASST 2 cut(s) 118, 228
SfoI GGCGCC 1 cut(s) 148
Sse9I AATT 4 cut(s) 63, 82, 131, 175
SsiI CCGC 1 cut(s) 260
SspDI GGCGCC 1 cut(s) 146
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 262
StyI CCWWGG 1 cut(s) 283
TasI AATT 4 cut(s) 63, 82, 131, 175
TatI WGTACW 1 cut(s) 137
TfiI GAWTC 1 cut(s) 218
TscAI CASTG 2 cut(s) 93, 189
TspDTI ATGAA 1 cut(s) 35
TspRI CASTG 2 cut(s) 93, 189
XagI CCTNNNNNAGG 1 cut(s) 13
XapI RAATTY 2 cut(s) 82, 131
XceI RCATGY 1 cut(s) 37
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.