RchiOBHm_Chr5g0081391
MADS Family

MADS-box protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
87381346 .. 87383853
2508 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 741 bp
ATGCCACCCACCCTCCATCAGTCTCTCGATCCCATCTCTCACTCGATCCCATCTCTCATCTCCCTCTGCTCTCTCCCATCTCCCATCTCCCCTCTCCCCTCTGCTCGATCTCCCTTCTCCCTCTGCTCGAACGCATCCCATCCGATCTCCCTTCTCCCTCCATCCGATCTCTCTCAAATAACCCATCACAGAACGCATCCAATCCCTGCTCGATCTCCCATCGGTCTCCGGTCGATCTCCCTTTGCTCGGTCTCCGGTCGATCTCCCATCTCCATCGGTCGATCTCCCATCTCCATCCGGTCGATCTCCTCTGCTCGGTCTCTGCTCGGTCTCCGGTCGATCTCTGGTCGATCTCCGCTCTCCTCTGGTCGATCTCCCTCTGCTCGGTCTCCGGTCGATCTCCCTCCGCTCGGTCTCCGGTCGGTCTCCCTGCTCGGTCTATCTCCTCTGCTCGGTCTCCCTCTGTTCGATCTCCCTCTCACAGAACCCATCCAATCACAGAACGCATCTCGGCCTCACTTGCATCTGAAATTGAAGCCTCAATCAAGCAATTTTCGAATCAAGCAAGAAAGACTCCTCACAGCTGAAAATCAGAGGCTAAATGAGAAGTGTGAGGCTATGCAACCAAGGCAACCAGTAAGTGAGCAGAGAGAAAACTTAGCCTGCACTGAAAGTAGTCCAAGTTCAGGTGTTGACATTGAATTGTTCGTTGGATTGCCAGAAAGAAGATCGAAGCACTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

246

Amino Acids

26.53

Weight (kDa)

10.68

Isoelectric Point (pI)

97.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 358, 409
AciI CCGC 2 cut(s) 356, 407
AclWI GGATC 2 cut(s) 23, 40
AfiI CCNNNNNNNGG 6 cut(s) 247, 315, 384, 410, 452, 686
AgsI TTSAA 2 cut(s) 535, 701
AjuI GAANNNNNNNTTGG 2 cut(s) 693, 725
AluBI AGCT 1 cut(s) 584
AluI AGCT 1 cut(s) 584
Alw26I GTCTC 9 cut(s) 27, 230, 256, 324, 335, 393, 419, 430, 461
AlwI GGATC 2 cut(s) 23, 40
AoxI GGCC 1 cut(s) 512
AsuII TTCGAA 1 cut(s) 556
BcoDI GTCTC 9 cut(s) 27, 230, 256, 324, 335, 393, 419, 430, 461
BfaI CTAG 1 cut(s) 739
BmsI GCATC 4 cut(s) 143, 205, 515, 532
Bpu14I TTCGAA 1 cut(s) 556
BsaI GGTCTC 8 cut(s) 230, 256, 324, 335, 393, 419, 430, 461
BsaJI CCNNGG 1 cut(s) 626
BsaWI WCCGGW 6 cut(s) 228, 254, 297, 333, 391, 417
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 6 cut(s) 247, 315, 384, 410, 452, 686
Bse1I ACTGG 1 cut(s) 635
BseDI CCNNGG 1 cut(s) 626
BseGI GGATG 6 cut(s) 134, 139, 161, 196, 294, 489
BseLI CCNNNNNNNGG 6 cut(s) 247, 315, 384, 410, 452, 686
BseNI ACTGG 1 cut(s) 635
BseRI GAGGAG 4 cut(s) 298, 352, 435, 566
BsgI GTGCAG 1 cut(s) 649
Bsh1285I CGRYCG 7 cut(s) 233, 259, 280, 302, 338, 396, 422
BshFI GGCC 1 cut(s) 514
BsiEI CGRYCG 7 cut(s) 233, 259, 280, 302, 338, 396, 422
BsiSI CCGG 6 cut(s) 229, 255, 298, 334, 392, 418
BslI CCNNNNNNNGG 6 cut(s) 247, 315, 384, 410, 452, 686
BsmAI GTCTC 9 cut(s) 27, 230, 256, 324, 335, 393, 419, 430, 461
BsnI GGCC 1 cut(s) 514
Bso31I GGTCTC 8 cut(s) 230, 256, 324, 335, 393, 419, 430, 461
Bsp119I TTCGAA 1 cut(s) 556
BspACI CCGC 2 cut(s) 356, 407
BspANI GGCC 1 cut(s) 514
BspPI GGATC 2 cut(s) 23, 40
BspT104I TTCGAA 1 cut(s) 556
BspTNI GGTCTC 8 cut(s) 230, 256, 324, 335, 393, 419, 430, 461
BsrBI CCGCTC 2 cut(s) 358, 409
BsrI ACTGG 1 cut(s) 635
BssECI CCNNGG 1 cut(s) 626
BssT1I CCWWGG 1 cut(s) 626
BstBI TTCGAA 1 cut(s) 556
BstC8I GCNNGC 1 cut(s) 664
BstDEI CTNAG 1 cut(s) 658
BstF5I GGATG 6 cut(s) 134, 139, 161, 196, 294, 489
BstMAI GTCTC 9 cut(s) 27, 230, 256, 324, 335, 393, 419, 430, 461
BstMCI CGRYCG 7 cut(s) 233, 259, 280, 302, 338, 396, 422
BstMWI GCNNNNNNNGC 2 cut(s) 520, 628
BsuRI GGCC 1 cut(s) 514
BtsCI GGATG 6 cut(s) 134, 139, 161, 196, 294, 489
BtsIMutI CAGTG 1 cut(s) 666
Cac8I GCNNGC 1 cut(s) 664
CviJI RGCY 6 cut(s) 514, 538, 584, 598, 617, 662
CviKI_1 RGCY 6 cut(s) 514, 538, 584, 598, 617, 662
DdeI CTNAG 1 cut(s) 658
Eco130I CCWWGG 1 cut(s) 626
Eco31I GGTCTC 8 cut(s) 230, 256, 324, 335, 393, 419, 430, 461
EcoT14I CCWWGG 1 cut(s) 626
ErhI CCWWGG 1 cut(s) 626
FaiI YATR 1 cut(s) 620
FokI GGATG 6 cut(s) 121, 126, 148, 183, 281, 476
FspBI CTAG 1 cut(s) 739
HaeIII GGCC 1 cut(s) 514
HapII CCGG 6 cut(s) 229, 255, 298, 334, 392, 418
HincII GTYRAC 1 cut(s) 694
HindII GTYRAC 1 cut(s) 694
HinfI GANTC 2 cut(s) 558, 573
HpaII CCGG 6 cut(s) 229, 255, 298, 334, 392, 418
Hpy166II GTNNAC 1 cut(s) 694
Hpy188I TCNGA 4 cut(s) 144, 166, 528, 594
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 1 cut(s) 694
HpyAV CCTTC 2 cut(s) 124, 161
HpyCH4V TGCA 3 cut(s) 523, 622, 666
HpyF10VI GCNNNNNNNGC 2 cut(s) 520, 628
HpyF3I CTNAG 1 cut(s) 658
LweI GCATC 4 cut(s) 143, 205, 515, 532
MaeI CTAG 1 cut(s) 739
MbiI CCGCTC 2 cut(s) 358, 409
MboII GAAGA 1 cut(s) 738
MluCI AATT 3 cut(s) 530, 550, 701
MlyI GAGTC 1 cut(s) 567
MmeI TCCRAC 1 cut(s) 691
MspA1I CMGCKG 1 cut(s) 584
MspI CCGG 6 cut(s) 229, 255, 298, 334, 392, 418
MwoI GCNNNNNNNGC 2 cut(s) 520, 628
NmeAIII GCCGAG 1 cut(s) 490
NspV TTCGAA 1 cut(s) 556
PfeI GAWTC 1 cut(s) 558
PleI GAGTC 1 cut(s) 567
PpsI GAGTC 1 cut(s) 567
PsrI GAACNNNNNNTAC 2 cut(s) 667, 699
PvuII CAGCTG 1 cut(s) 584
SchI GAGTC 1 cut(s) 567
SetI ASST 2 cut(s) 586, 691
SfaNI GCATC 4 cut(s) 143, 205, 515, 532
SfuI TTCGAA 1 cut(s) 556
Sse9I AATT 3 cut(s) 530, 550, 701
SsiI CCGC 2 cut(s) 356, 407
SspMI CTAG 1 cut(s) 739
StyI CCWWGG 1 cut(s) 626
TasI AATT 3 cut(s) 530, 550, 701
TfiI GAWTC 1 cut(s) 558
TscAI CASTG 1 cut(s) 673
TspRI CASTG 1 cut(s) 673
XspI CTAG 1 cut(s) 739
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.