RchiOBHm_Chr4g0386371
ERF Family

Transmembrane 9 superfamily member

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
1876656 .. 1876922
267 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGTGCAATATTGTCTGTCAGTTTACACCTGATGCCAAAACTGTAAAGCAGTTTAAAGAGAAGATAGATGATCAGTATCGAGTGAACATGATCCTTGATAATCTGCCTCTAGTGGTTCCCATTCAAAGGCCATATCAGGAATCACCTACCATTTATCAGCTTGGCTTTTCACGTTGGGCTTAA

Protein Analysis

60

Amino Acids

7.09

Weight (kDa)

7.76

Isoelectric Point (pI)

43.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMP70 PF02990 2 - 56 9.1e-09 Endomembrane protein 70
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022596)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0319081 RchiOBHm_Chr4g0386371
rosa_samantha Rh2AG527600 Rh2CG512100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
AlwI GGATC 1 cut(s) 85
AoxI GGCC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 135
BclI TGATCA 1 cut(s) 70
BfaI CTAG 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 117
BmsI GCATC 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 75
BseJI GATNNNNATC 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 126
BshFI GGCC 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 126
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 70, 90
BspANI GGCC 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 117
BspPI GGATC 1 cut(s) 85
BssMI GATC 2 cut(s) 70, 90
Bst4CI ACNGT 1 cut(s) 43
BstKTI GATC 2 cut(s) 73, 93
BstMBI GATC 2 cut(s) 70, 90
BsuRI GGCC 1 cut(s) 130
CviAII CATG 1 cut(s) 88
CviJI RGCY 4 cut(s) 130, 160, 165, 179
CviKI_1 RGCY 4 cut(s) 130, 160, 165, 179
DpnI GATC 2 cut(s) 72, 92
DpnII GATC 2 cut(s) 70, 90
DraI TTTAAA 1 cut(s) 55
FaeI CATG 1 cut(s) 91
FaiI YATR 2 cut(s) 89, 133
FatI CATG 1 cut(s) 87
FbaI TGATCA 1 cut(s) 70
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 130
Hin1II CATG 1 cut(s) 91
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 135
Hpy166II GTNNAC 2 cut(s) 24, 85
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 2 cut(s) 24, 85
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 6
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 1 cut(s) 91
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 2 cut(s) 70, 90
LpnPI CCDG 2 cut(s) 42, 122
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 110
MaeII ACGT 1 cut(s) 172
MalI GATC 2 cut(s) 72, 92
MboI GATC 2 cut(s) 70, 90
MboII GAAGA 1 cut(s) 73
MnlI CCTC 1 cut(s) 117
MseI TTAA 2 cut(s) 54, 181
NdeII GATC 2 cut(s) 70, 90
NlaIII CATG 1 cut(s) 91
NlaIV GGNNCC 1 cut(s) 117
PfeI GAWTC 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 117
SaqAI TTAA 2 cut(s) 54, 181
Sau3AI GATC 2 cut(s) 70, 90
SetI ASST 4 cut(s) 31, 148, 162, 175
SfaNI GCATC 1 cut(s) 22
SgeI CNNG 7 cut(s) 41, 92, 100, 107, 122, 149, 173
SspI AATATT 1 cut(s) 10
SspMI CTAG 1 cut(s) 110
TaaI ACNGT 1 cut(s) 43
TaiI ACGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 79
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 2 cut(s) 54, 181
Tru9I TTAA 2 cut(s) 54, 181
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.