RchiOBHm_Chr4g0387061

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
2355599 .. 2356852
1254 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGGTATTAGAGCAGAAATACTCACAAGGTATTGAATGGATCAACTTGTGGAATTGCCATCGATTGTGTGACAGTCTAGGTATTTGTATGGAAAAGTTGGAAAGAATTATATTGAATCAGGTGTCTGAAGAAGTTACGCCAACTAATGGTGTATCCATTGAATTTGGAGCTTACATTTGGATTAATAATGTATATGTAGATGGTGATTTCTGGTTTCATAAGAAGTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

9.05

Weight (kDa)

4.92

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 161
AcuI CTGAAG 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 3 cut(s) 35, 115, 161
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AlwI GGATC 1 cut(s) 47
ApoI RAATTY 1 cut(s) 161
AseI ATTAAT 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 215
BccI CCATC 2 cut(s) 66, 194
BciVI GTATCC 1 cut(s) 163
BfaI CTAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 163
Bsa29I ATCGAT 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseCI ATCGAT 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 146
BshVI ATCGAT 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 146
Bsp143I GATC 1 cut(s) 39
BspDI ATCGAT 1 cut(s) 61
BspPI GGATC 1 cut(s) 47
BssMI GATC 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 74
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
Bsu15I ATCGAT 1 cut(s) 61
BsuI GTATCC 1 cut(s) 163
BsuTUI ATCGAT 1 cut(s) 61
ClaI ATCGAT 1 cut(s) 61
CviJI RGCY 1 cut(s) 170
CviKI_1 RGCY 1 cut(s) 170
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
Eco57I CTGAAG 1 cut(s) 147
FaiI YATR 5 cut(s) 89, 110, 193, 195, 219
FspBI CTAG 1 cut(s) 77
HinfI GANTC 1 cut(s) 115
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 74
Kzo9I GATC 1 cut(s) 39
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 2 cut(s) 104, 196
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 2 cut(s) 68, 133
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 1 cut(s) 140
MluCI AATT 3 cut(s) 52, 105, 161
MmeI TCCRAC 1 cut(s) 78
MseI TTAA 1 cut(s) 183
NdeII GATC 1 cut(s) 39
NmuCI GTSAC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 115
PflMI CCANNNNNTGG 1 cut(s) 146
PshBI ATTAAT 1 cut(s) 183
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 1 cut(s) 39
SetI ASST 4 cut(s) 31, 82, 123, 172
SgeI CNNG 5 cut(s) 38, 58, 89, 131, 223
Sse9I AATT 3 cut(s) 52, 105, 161
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 74
TaqI TCGA 1 cut(s) 61
TasI AATT 3 cut(s) 52, 105, 161
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 1 cut(s) 206
Van91I CCANNNNNTGG 1 cut(s) 146
VspI ATTAAT 1 cut(s) 183
XapI RAATTY 1 cut(s) 161
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.