Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0030030

Physical Location & Seq

Genomic Coordinates Reverse (-)

3887695 .. 3887883

Gene Structure 189 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGTTGAACCCAAATTTCAGATTCTTAAAAGGAGCATGGCCAATCAACTCACCGATGATCAGATCTAAGTTCAAGGAAGCCTTTAGCCTCTTCAACAAGGACGGCGATGGTTGTATCACTACCAAGGAGCTTGGGACTGTAATGAGGTCACTGGGGCCAGAACCCAACCCAGGACATGATCATCAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 ko04015 ko04016 ko04020 ko04022 ko04024 ko04070 ko04114 ko04218 ko04261 ko04270 ko04371 ko04626 ko04713 ko04720 ko04722 ko04728 ko04740 ko04744 ko04745 ko04750 ko04910 ko04912 ko04915 ko04916 ko04921 ko04922 ko04924 ko04925 ko04970 ko04971 ko05010 ko05031 ko05034 ko05133 ko05152 ko05167 ko05200 ko05214 ko05418 map04014 map04015 map04016 map04020 map04022 map04024 map04070 map04114 map04218 map04261 map04270 map04371 map04626 map04713 map04720 map04722 map04728 map04740 map04744 map04745 map04750 map04910 map04912 map04915 map04916 map04921 map04922 map04924 map04925 map04970 map04971 map05010 map05031 map05034 map05133 map05152 map05167 map05200 map05214 map05418

Pfam Domains

Protein Families

EF-hand_1

Protein Analysis

62

Amino Acids

6.97

Weight (kDa)

9.03

Isoelectric Point (pI)

27.14

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
EF-hand_6	PF13405	23 - 52	1.9e-08	EF-hand domain
EF-hand_1	PF00036	23 - 51	1.4e-07	EF hand domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030030)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0388621
rosa_rugosa	Rorug03G0319700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	38
AcsI	RAATTY	1 cut(s)	13
AfiI	CCNNNNNNNGG	1 cut(s)	170
AgsI	TTSAA	3 cut(s)	7, 73, 94
AjnI	CCWGG	1 cut(s)	169
AluBI	AGCT	1 cut(s)	130
AluI	AGCT	1 cut(s)	130
AoxI	GGCC	2 cut(s)	38, 155
ApoI	RAATTY	1 cut(s)	13
AspS9I	GGNCC	1 cut(s)	155
AsuHPI	GGTGA	1 cut(s)	42
BalI	TGGCCA	1 cut(s)	40
BccI	CCATC	1 cut(s)	101
BceAI	ACGGC	1 cut(s)	118
BciT130I	CCWGG	1 cut(s)	171
BclI	TGATCA	2 cut(s)	57, 178
BglII	AGATCT	1 cut(s)	62
Bme1390I	CCNGG	1 cut(s)	171
BmgT120I	GGNCC	1 cut(s)	155
BmiI	GGNNCC	1 cut(s)	156
BmrFI	CCNGG	1 cut(s)	171
BmrI	ACTGGG	1 cut(s)	161
BmuI	ACTGGG	1 cut(s)	161
BsaJI	CCNNGG	2 cut(s)	123, 169
Bsc4I	CCNNNNNNNGG	1 cut(s)	170
Bse1I	ACTGG	1 cut(s)	156
BseBI	CCWGG	1 cut(s)	171
BseDI	CCNNGG	2 cut(s)	123, 169
BseLI	CCNNNNNNNGG	1 cut(s)	170
BseNI	ACTGG	1 cut(s)	156
BshFI	GGCC	2 cut(s)	40, 157
BslFI	GGGAC	1 cut(s)	148
BslI	CCNNNNNNNGG	1 cut(s)	170
BsmFI	GGGAC	1 cut(s)	148
BsnI	GGCC	2 cut(s)	40, 157
Bsp143I	GATC	3 cut(s)	57, 62, 178
BspANI	GGCC	2 cut(s)	40, 157
BspLI	GGNNCC	1 cut(s)	156
BsrI	ACTGG	1 cut(s)	156
BssECI	CCNNGG	2 cut(s)	123, 169
BssMI	GATC	3 cut(s)	57, 62, 178
BssT1I	CCWWGG	1 cut(s)	123
Bst2UI	CCWGG	1 cut(s)	171
Bst4CI	ACNGT	1 cut(s)	139
Bst6I	CTCTTC	1 cut(s)	95
BstDEI	CTNAG	1 cut(s)	66
BstKTI	GATC	3 cut(s)	60, 65, 181
BstMBI	GATC	3 cut(s)	57, 62, 178
BstNI	CCWGG	1 cut(s)	171
BstSCI	CCNGG	1 cut(s)	169
BstX2I	RGATCY	1 cut(s)	62
BstYI	RGATCY	1 cut(s)	62
BsuRI	GGCC	2 cut(s)	40, 157
BtgZI	GCGATG	1 cut(s)	120
BtsIMutI	CAGTG	1 cut(s)	149
Cfr13I	GGNCC	1 cut(s)	155
CviAII	CATG	2 cut(s)	36, 176
CviJI	RGCY	5 cut(s)	40, 80, 87, 130, 157
CviKI_1	RGCY	5 cut(s)	40, 80, 87, 130, 157
DdeI	CTNAG	1 cut(s)	66
DpnI	GATC	3 cut(s)	59, 64, 180
DpnII	GATC	3 cut(s)	57, 62, 178
EaeI	YGGCCR	1 cut(s)	38
Eam1104I	CTCTTC	1 cut(s)	95
EarI	CTCTTC	1 cut(s)	95
Eco130I	CCWWGG	1 cut(s)	123
EcoRII	CCWGG	1 cut(s)	169
EcoT14I	CCWWGG	1 cut(s)	123
ErhI	CCWWGG	1 cut(s)	123
FaeI	CATG	2 cut(s)	39, 179
FaiI	YATR	2 cut(s)	37, 177
FalI	AAGNNNNNCTT	2 cut(s)	65, 97
FaqI	GGGAC	1 cut(s)	148
FatI	CATG	2 cut(s)	35, 175
FbaI	TGATCA	2 cut(s)	57, 178
HaeIII	GGCC	2 cut(s)	40, 157
Hin1II	CATG	2 cut(s)	39, 179
HinfI	GANTC	1 cut(s)	21
HphI	GGTGA	1 cut(s)	42
Hpy188I	TCNGA	2 cut(s)	20, 62
HpyCH4III	ACNGT	1 cut(s)	139
HpyF3I	CTNAG	1 cut(s)	66
Hsp92II	CATG	2 cut(s)	39, 179
Ksp22I	TGATCA	2 cut(s)	57, 178
Kzo9I	GATC	3 cut(s)	57, 62, 178
LmnI	GCTCC	2 cut(s)	32, 127
LpnPI	CCDG	4 cut(s)	137, 156, 171, 183
MaeIII	GTNAC	1 cut(s)	147
MalI	GATC	3 cut(s)	59, 64, 180
MboI	GATC	3 cut(s)	57, 62, 178
MboII	GAAGA	1 cut(s)	82
MflI	RGATCY	1 cut(s)	62
MlsI	TGGCCA	1 cut(s)	40
MluCI	AATT	1 cut(s)	13
MluNI	TGGCCA	1 cut(s)	40
MnlI	CCTC	2 cut(s)	98, 138
Mox20I	TGGCCA	1 cut(s)	40
MscI	TGGCCA	1 cut(s)	40
MseI	TTAA	1 cut(s)	26
Msp20I	TGGCCA	1 cut(s)	40
MspR9I	CCNGG	1 cut(s)	171
MvaI	CCWGG	1 cut(s)	171
NdeII	GATC	3 cut(s)	57, 62, 178
NlaIII	CATG	2 cut(s)	39, 179
NlaIV	GGNNCC	1 cut(s)	156
NmuCI	GTSAC	1 cut(s)	147
PfeI	GAWTC	1 cut(s)	21
Psp6I	CCWGG	1 cut(s)	169
PspGI	CCWGG	1 cut(s)	169
PspN4I	GGNNCC	1 cut(s)	156
PspPI	GGNCC	1 cut(s)	155
PsuI	RGATCY	1 cut(s)	62
SaqAI	TTAA	1 cut(s)	26
Sau3AI	GATC	3 cut(s)	57, 62, 178
Sau96I	GGNCC	1 cut(s)	155
ScrFI	CCNGG	1 cut(s)	171
SetI	ASST	2 cut(s)	132, 149
SgeI	CNNG	9 cut(s)	48, 85, 109, 136, 143, 164, 170, 182, 183
Sse9I	AATT	1 cut(s)	13
StyD4I	CCNGG	1 cut(s)	169
StyI	CCWWGG	1 cut(s)	123
TaaI	ACNGT	1 cut(s)	139
TasI	AATT	1 cut(s)	13
TfiI	GAWTC	1 cut(s)	21
Tru1I	TTAA	1 cut(s)	26
Tru9I	TTAA	1 cut(s)	26
TscAI	CASTG	1 cut(s)	156
TseFI	GTSAC	1 cut(s)	147
Tsp45I	GTSAC	1 cut(s)	147
TspRI	CASTG	1 cut(s)	156
XapI	RAATTY	1 cut(s)	13

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.