RchiOBHm_Chr4g0388721

Protein FAR1-RELATED SEQUENCE 5-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
3941787 .. 3942275
489 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
ATGCTCAATGTTTGCTTAATTACTTTAAGAAGAAGCAAATGGAGGATAAGTCATTTTTTTATGCAATTCGAACAAACATCGACAATGAAATATGTGGTTTTTTTTTGTGTGATGGAAAATCAAGGAGTGATTATGCTATATTTGGTGATGCGGTTGTCTTTGATACAACCTTCAAAACCAACAAGTACGACATGGTTTCTGCTCCAATTGTTGGAGTTAATCATCATGGTCAAACAATTCTATTTGGCTGTGGGTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.31

Weight (kDa)

9.62

Isoelectric Point (pI)

31.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 211
AciI CCGC 1 cut(s) 151
AfaI GTAC 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 211
AgsI TTSAA 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 157
AsuII TTCGAA 1 cut(s) 69
BccI CCATC 1 cut(s) 106
BmsI GCATC 1 cut(s) 138
Bpu14I TTCGAA 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 211
BslI CCNNNNNNNGG 1 cut(s) 211
Bsp119I TTCGAA 1 cut(s) 69
BspACI CCGC 1 cut(s) 151
BspT104I TTCGAA 1 cut(s) 69
BstBI TTCGAA 1 cut(s) 69
Csp6I GTAC 1 cut(s) 186
CviAII CATG 2 cut(s) 192, 226
CviJI RGCY 1 cut(s) 248
CviKI_1 RGCY 1 cut(s) 248
CviQI GTAC 1 cut(s) 186
FaeI CATG 2 cut(s) 195, 229
FaiI YATR 6 cut(s) 62, 93, 134, 139, 193, 227
FatI CATG 2 cut(s) 191, 225
Hin1II CATG 2 cut(s) 195, 229
HphI GGTGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 64
Hsp92II CATG 2 cut(s) 195, 229
LmnI GCTCC 1 cut(s) 207
LweI GCATC 1 cut(s) 138
MboII GAAGA 1 cut(s) 42
MfeI CAATTG 1 cut(s) 206
MluCI AATT 4 cut(s) 18, 65, 206, 236
MmeI TCCRAC 1 cut(s) 192
MnlI CCTC 1 cut(s) 36
MseI TTAA 3 cut(s) 17, 26, 218
MunI CAATTG 1 cut(s) 206
NlaIII CATG 2 cut(s) 195, 229
NspV TTCGAA 1 cut(s) 69
PflMI CCANNNNNTGG 1 cut(s) 211
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 3 cut(s) 17, 26, 218
SetI ASST 1 cut(s) 172
SfaNI GCATC 1 cut(s) 138
SfuI TTCGAA 1 cut(s) 69
SgeI CNNG 4 cut(s) 134, 195, 204, 238
Sse9I AATT 4 cut(s) 18, 65, 206, 236
SsiI CCGC 1 cut(s) 151
TaqI TCGA 2 cut(s) 69, 80
TasI AATT 4 cut(s) 18, 65, 206, 236
Tru1I TTAA 3 cut(s) 17, 26, 218
Tru9I TTAA 3 cut(s) 17, 26, 218
TspDTI ATGAA 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.