RchiOBHm_Chr4g0389131

RESISTANCE protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
4273165 .. 4273984
820 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGAAGCAAAGCAAGCAGAATATGGCTTTTCTGACCAATGAAGCCAGTTCTTCATCTTCTTCTCTCCCACTTTCTTCTACTGATCACCATTCTACTGATCACCAAAATCATTACACATACGAGGTTTTCCTGAGTTTCCGTGGCGAGGATACGCGCTACGATTTTACAGATCATTTGTACAACGCTTTGTGTCTGAGGGGAATTAAGACCTTCAGAGATGATAAGCTTAGCATAGGACTATAG

Protein Analysis

80

Amino Acids

9.21

Weight (kDa)

6.15

Isoelectric Point (pI)

41.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIR PF01582 40 - 76 1.4e-07 TIR domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 196
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 145
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
AspLEI GCGC 1 cut(s) 156
AsuHPI GGTGA 2 cut(s) 77, 92
BciVI GTATCC 1 cut(s) 142
BclI TGATCA 2 cut(s) 82, 97
BfmI CTRYAG 1 cut(s) 239
BfuI GTATCC 1 cut(s) 142
BlpI GCTNAGC 1 cut(s) 227
Bpu1102I GCTNAGC 1 cut(s) 227
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 145
BseMII CTCAG 2 cut(s) 122, 185
BseNI ACTGG 1 cut(s) 45
Bsh1236I CGCG 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 145
Bsp1407I TGTACA 1 cut(s) 177
Bsp143I GATC 3 cut(s) 82, 97, 169
Bsp1720I GCTNAGC 1 cut(s) 227
BspCNI CTCAG 2 cut(s) 123, 186
BspFNI CGCG 1 cut(s) 154
BsrGI TGTACA 1 cut(s) 177
BsrI ACTGG 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 3 cut(s) 82, 97, 169
BstAUI TGTACA 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 14
BstDEI CTNAG 3 cut(s) 131, 194, 227
BstDSI CCRYGG 1 cut(s) 139
BstFNI CGCG 1 cut(s) 154
BstHHI GCGC 1 cut(s) 156
BstKTI GATC 3 cut(s) 85, 100, 172
BstMBI GATC 3 cut(s) 82, 97, 169
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 239
BstUI CGCG 1 cut(s) 154
BsuI GTATCC 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 14
CfoI GCGC 1 cut(s) 156
Csp6I GTAC 1 cut(s) 178
CviJI RGCY 3 cut(s) 26, 44, 226
CviKI_1 RGCY 3 cut(s) 26, 44, 226
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 3 cut(s) 131, 194, 227
DpnI GATC 3 cut(s) 84, 99, 171
DpnII GATC 3 cut(s) 82, 97, 169
Eco57I CTGAAG 1 cut(s) 196
FaiI YATR 4 cut(s) 23, 118, 233, 241
FbaI TGATCA 2 cut(s) 82, 97
GlaI GCGC 1 cut(s) 155
HhaI GCGC 1 cut(s) 156
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HindIII AAGCTT 1 cut(s) 224
HphI GGTGA 2 cut(s) 77, 92
Hpy188I TCNGA 3 cut(s) 33, 195, 215
Hpy188III TCNNGA 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 220
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
HpyF3I CTNAG 3 cut(s) 131, 194, 227
HspAI GCGC 1 cut(s) 154
Ksp22I TGATCA 2 cut(s) 82, 97
Kzo9I GATC 3 cut(s) 82, 97, 169
LpnPI CCDG 2 cut(s) 58, 143
MalI GATC 3 cut(s) 84, 99, 171
MboI GATC 3 cut(s) 82, 97, 169
MboII GAAGA 4 cut(s) 42, 48, 51, 66
MluCI AATT 1 cut(s) 201
MnlI CCTC 3 cut(s) 115, 139, 189
MseI TTAA 1 cut(s) 204
MvnI CGCG 1 cut(s) 154
MwoI GCNNNNNNNGC 1 cut(s) 13
NdeII GATC 3 cut(s) 82, 97, 169
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 3 cut(s) 82, 97, 169
SetI ASST 3 cut(s) 126, 212, 228
SfcI CTRYAG 1 cut(s) 239
SgeI CNNG 7 cut(s) 25, 57, 133, 142, 152, 157, 165
Sse9I AATT 1 cut(s) 201
TasI AATT 1 cut(s) 201
TatI WGTACW 1 cut(s) 177
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TspDTI ATGAA 3 cut(s) 17, 42, 54
TspGWI ACGGA 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.