RchiOBHm_Chr4g0392171

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
7575543 .. 7575758
216 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGATGGAATCAATCAGAAGTGCAAATCGCGCAAGCGAAGCGACCGCACCGAAACAGGACTCCAAATTCAATACCAAAACAAATGGATTGATGTTCCTCCTATGCCTGAAGCTCTAGTGGTGAACGTTGGGGATTTCTTGCAGGCAAGATCTCTATATCGTATATCTTCAGCACGGTGGTTTACCTCTGATCATTTTATTGTGTTCTATATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.37

Weight (kDa)

9.36

Isoelectric Point (pI)

60.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 18 - 49 4.2e-07 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 31
AciI CCGC 1 cut(s) 46
AclI AACGTT 1 cut(s) 126
AcsI RAATTY 1 cut(s) 66
AcuI CTGAAG 2 cut(s) 129, 153
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
ApoI RAATTY 1 cut(s) 66
AspLEI GCGC 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 133
BclI TGATCA 1 cut(s) 190
BfaI CTAG 1 cut(s) 116
BglII AGATCT 1 cut(s) 149
BseGI GGATG 1 cut(s) 10
Bsh1236I CGCG 1 cut(s) 31
Bsh1285I CGRYCG 1 cut(s) 46
BsiEI CGRYCG 1 cut(s) 46
Bsp143I GATC 2 cut(s) 149, 190
BspACI CCGC 1 cut(s) 46
BspFNI CGCG 1 cut(s) 31
BssMI GATC 2 cut(s) 149, 190
Bst4CI ACNGT 1 cut(s) 177
BstC8I GCNNGC 2 cut(s) 35, 144
BstF5I GGATG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 31
BstHHI GCGC 1 cut(s) 33
BstKTI GATC 2 cut(s) 152, 193
BstMBI GATC 2 cut(s) 149, 190
BstMCI CGRYCG 1 cut(s) 46
BstMWI GCNNNNNNNGC 2 cut(s) 30, 39
BstUI CGCG 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 2 cut(s) 35, 144
CfoI GCGC 1 cut(s) 33
CviJI RGCY 1 cut(s) 113
CviKI_1 RGCY 1 cut(s) 113
DpnI GATC 2 cut(s) 151, 192
DpnII GATC 2 cut(s) 149, 190
Eco57I CTGAAG 2 cut(s) 129, 153
FaiI YATR 6 cut(s) 104, 157, 164, 210, 212, 214
FbaI TGATCA 1 cut(s) 190
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 116
GlaI GCGC 1 cut(s) 32
HhaI GCGC 1 cut(s) 33
Hin6I GCGC 1 cut(s) 31
HinP1I GCGC 1 cut(s) 31
HinfI GANTC 2 cut(s) 9, 60
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 2 cut(s) 124, 183
Hpy188I TCNGA 2 cut(s) 18, 190
Hpy8I GTNNAC 2 cut(s) 124, 183
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 24, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 30, 39
HpySE526I ACGT 1 cut(s) 126
HspAI GCGC 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 2 cut(s) 149, 190
LpnPI CCDG 3 cut(s) 42, 120, 128
MaeI CTAG 1 cut(s) 116
MaeII ACGT 1 cut(s) 126
MalI GATC 2 cut(s) 151, 192
MboI GATC 2 cut(s) 149, 190
MboII GAAGA 1 cut(s) 159
MflI RGATCY 1 cut(s) 149
MluCI AATT 1 cut(s) 66
MlyI GAGTC 1 cut(s) 54
MnlI CCTC 2 cut(s) 108, 196
MvnI CGCG 1 cut(s) 31
MwoI GCNNNNNNNGC 2 cut(s) 30, 39
NdeII GATC 2 cut(s) 149, 190
PfeI GAWTC 1 cut(s) 9
PleI GAGTC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 54
Psp1406I AACGTT 1 cut(s) 126
PsuI RGATCY 1 cut(s) 149
Sau3AI GATC 2 cut(s) 149, 190
SchI GAGTC 1 cut(s) 54
SetI ASST 3 cut(s) 115, 129, 188
SgeI CNNG 9 cut(s) 42, 46, 69, 119, 128, 151, 155, 159, 186
Sse9I AATT 1 cut(s) 66
SsiI CCGC 1 cut(s) 46
SspMI CTAG 1 cut(s) 116
TaaI ACNGT 1 cut(s) 177
TaiI ACGT 1 cut(s) 129
TasI AATT 1 cut(s) 66
TfiI GAWTC 1 cut(s) 9
XapI RAATTY 1 cut(s) 66
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.