RchiOBHm_Chr4g0392201

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
7592432 .. 7594460
2029 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGGAGTACCGCCGGCCCGCAGGGTCAAAAGCCCGACCAGGCCAGTCAAAAAGCCCTCAAAAACCCTTAATCTCAAATGATAAGTTCATAAGTGTCAATCACAAAGTATTAGCCCAAAATGTCGGTCTAAGAATTTTCGTGGCGTGTTTTTTTAGACAACATCTTCTACCGGAAAATTCCTCCATATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.12

Weight (kDa)

10.61

Isoelectric Point (pI)

65.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 10, 18
AcsI RAATTY 2 cut(s) 132, 175
AfaI GTAC 1 cut(s) 8
AjnI CCWGG 1 cut(s) 37
AoxI GGCC 2 cut(s) 14, 40
ApoI RAATTY 2 cut(s) 132, 175
ArsI GACNNNNNNTTYG 2 cut(s) 109, 141
AspS9I GGNCC 1 cut(s) 15
BciT130I CCWGG 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 39
BsaWI WCCGGW 1 cut(s) 169
Bse118I RCCGGY 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 43
BseBI CCWGG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 43
BshFI GGCC 2 cut(s) 16, 42
BsiSI CCGG 2 cut(s) 13, 170
BsnI GGCC 2 cut(s) 16, 42
BspACI CCGC 2 cut(s) 10, 18
BspANI GGCC 2 cut(s) 16, 42
BsrFI RCCGGY 1 cut(s) 12
BsrI ACTGG 1 cut(s) 43
BssAI RCCGGY 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 14, 18
BstDEI CTNAG 1 cut(s) 128
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
BsuRI GGCC 2 cut(s) 16, 42
Cac8I GCNNGC 2 cut(s) 14, 18
Cfr10I RCCGGY 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 5 cut(s) 16, 32, 42, 54, 113
CviKI_1 RGCY 5 cut(s) 16, 32, 42, 54, 113
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 37
FaiI YATR 2 cut(s) 89, 185
FauI CCCGC 1 cut(s) 25
HaeIII GGCC 2 cut(s) 16, 42
HapII CCGG 2 cut(s) 13, 170
HpaII CCGG 2 cut(s) 13, 170
HpyF3I CTNAG 1 cut(s) 128
KroI GCCGGC 1 cut(s) 12
KroNI GCCGGC 1 cut(s) 14
LpnPI CCDG 6 cut(s) 6, 24, 26, 51, 56, 183
MboII GAAGA 1 cut(s) 155
MluCI AATT 2 cut(s) 132, 175
MnlI CCTC 2 cut(s) 66, 190
MroNI GCCGGC 1 cut(s) 12
MseI TTAA 1 cut(s) 68
MspI CCGG 2 cut(s) 13, 170
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
NaeI GCCGGC 1 cut(s) 14
NgoMIV GCCGGC 1 cut(s) 12
PdiI GCCGGC 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
PspPI GGNCC 1 cut(s) 15
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SaqAI TTAA 1 cut(s) 68
Sau96I GGNCC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 39
Sse9I AATT 2 cut(s) 132, 175
SsiI CCGC 2 cut(s) 10, 18
StyD4I CCNGG 1 cut(s) 37
TaqII GACCGA 1 cut(s) 113
TasI AATT 2 cut(s) 132, 175
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TspDTI ATGAA 1 cut(s) 76
XapI RAATTY 2 cut(s) 132, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.