RchiOBHm_Chr4g0393971

60S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
9663690 .. 9664208
519 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 309 bp
ATGTTAGGTCATTTTATGTGCCAGTTATTATCATATCTGGTGACTTTGCATGTCGCTCTTGTTGATGCCCCTGATATGGTGAGATCTCAAATGAATTTCAAGAGGCATTCTCTCACTGACATCAAAATTGACATCAAAGTGGGTCCCCAAGAAGAAGGAATTTCTCTTGGGGTAGCTAGGAAGCTTATTGTTCAGATGCGAAGGGCCAATCTTAATGACTTTGATCGCTTCAAGCTTATGTTGGCTAAGATCAAGAGGGCTAGCCTGGTCAAGAGCGAACTTGCAAAACTGAAGAAACAGAGTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L14e

Protein Analysis

102

Amino Acids

11.61

Weight (kDa)

10.14

Isoelectric Point (pI)

26.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L14e PF01929 58 - 86 2.8e-08 Ribosomal protein L14
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 94, 159
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 2 cut(s) 100, 232
AjnI CCWGG 1 cut(s) 264
AluBI AGCT 3 cut(s) 176, 184, 235
AluI AGCT 3 cut(s) 176, 184, 235
AoxI GGCC 1 cut(s) 204
ApoI RAATTY 2 cut(s) 94, 159
AspS9I GGNCC 2 cut(s) 143, 204
AsuHPI GGTGA 2 cut(s) 52, 91
AsuNHI GCTAGC 1 cut(s) 260
AvaII GGWCC 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 266
BfaI CTAG 2 cut(s) 177, 261
BglII AGATCT 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 266
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 2 cut(s) 143, 204
BmiI GGNNCC 2 cut(s) 144, 145
BmrFI CCNGG 1 cut(s) 266
BmsI GCATC 2 cut(s) 55, 186
BmtI GCTAGC 1 cut(s) 264
BplI GAGNNNNNCTC 2 cut(s) 94, 126
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 22
BseBI CCWGG 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 76
BseNI ACTGG 1 cut(s) 22
BshFI GGCC 1 cut(s) 206
BslFI GGGAC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 76
BsmFI GGGAC 1 cut(s) 129
BsmI GAATGC 1 cut(s) 106
BsnI GGCC 1 cut(s) 206
Bsp143I GATC 3 cut(s) 83, 223, 249
BspANI GGCC 1 cut(s) 206
BspLI GGNNCC 2 cut(s) 144, 145
BspOI GCTAGC 1 cut(s) 264
BsrI ACTGG 1 cut(s) 22
BssMI GATC 3 cut(s) 83, 223, 249
Bst2UI CCWGG 1 cut(s) 266
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 2 cut(s) 246, 306
BstKTI GATC 3 cut(s) 86, 226, 252
BstMBI GATC 3 cut(s) 83, 223, 249
BstNI CCWGG 1 cut(s) 266
BstNSI RCATGY 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 264
BstX2I RGATCY 1 cut(s) 83
BstYI RGATCY 1 cut(s) 83
BsuRI GGCC 1 cut(s) 206
BtsIMutI CAGTG 1 cut(s) 114
Cac8I GCNNGC 1 cut(s) 262
Cfr13I GGNCC 2 cut(s) 143, 204
CviAII CATG 1 cut(s) 50
CviJI RGCY 7 cut(s) 176, 184, 206, 235, 245, 260, 264
CviKI_1 RGCY 7 cut(s) 176, 184, 206, 235, 245, 260, 264
DdeI CTNAG 2 cut(s) 246, 306
DpnI GATC 3 cut(s) 85, 225, 251
DpnII GATC 3 cut(s) 83, 223, 249
Eco47I GGWCC 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 264
FaeI CATG 1 cut(s) 53
FaiI YATR 5 cut(s) 17, 34, 51, 77, 239
FaqI GGGAC 1 cut(s) 129
FatI CATG 1 cut(s) 49
FspBI CTAG 2 cut(s) 177, 261
HaeIII GGCC 1 cut(s) 206
Hin1II CATG 1 cut(s) 53
HindIII AAGCTT 2 cut(s) 182, 233
HphI GGTGA 2 cut(s) 52, 91
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 3 cut(s) 100, 253, 271
HpyAV CCTTC 2 cut(s) 149, 195
HpyCH4V TGCA 2 cut(s) 49, 284
HpyF3I CTNAG 2 cut(s) 246, 306
Hsp92II CATG 1 cut(s) 53
KflI GGGWCCC 1 cut(s) 143
Kzo9I GATC 3 cut(s) 83, 223, 249
LpnPI CCDG 5 cut(s) 23, 35, 84, 251, 278
LweI GCATC 2 cut(s) 55, 186
MaeI CTAG 2 cut(s) 177, 261
MaeIII GTNAC 1 cut(s) 40
MalI GATC 3 cut(s) 85, 225, 251
MboI GATC 3 cut(s) 83, 223, 249
MboII GAAGA 2 cut(s) 164, 304
MflI RGATCY 1 cut(s) 83
MluCI AATT 3 cut(s) 94, 126, 159
MnlI CCTC 2 cut(s) 96, 249
MseI TTAA 1 cut(s) 213
MslI CAYNNNNRTG 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 266
Mva1269I GAATGC 1 cut(s) 106
MvaI CCWGG 1 cut(s) 266
NdeII GATC 3 cut(s) 83, 223, 249
NheI GCTAGC 1 cut(s) 260
NlaIII CATG 1 cut(s) 53
NlaIV GGNNCC 2 cut(s) 144, 145
NmuCI GTSAC 1 cut(s) 40
NspI RCATGY 1 cut(s) 53
PctI GAATGC 1 cut(s) 106
PpuMI RGGWCCY 1 cut(s) 143
Psp5II RGGWCCY 1 cut(s) 143
Psp6I CCWGG 1 cut(s) 264
PspGI CCWGG 1 cut(s) 264
PspN4I GGNNCC 2 cut(s) 144, 145
PspPI GGNCC 2 cut(s) 143, 204
PspPPI RGGWCCY 1 cut(s) 143
PsuI RGATCY 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 137
SaqAI TTAA 1 cut(s) 213
Sau3AI GATC 3 cut(s) 83, 223, 249
Sau96I GGNCC 2 cut(s) 143, 204
ScrFI CCNGG 1 cut(s) 266
SetI ASST 4 cut(s) 10, 178, 186, 237
SfaNI GCATC 2 cut(s) 55, 186
SinI GGWCC 1 cut(s) 143
SmiMI CAYNNNNRTG 1 cut(s) 137
Sse9I AATT 3 cut(s) 94, 126, 159
SspMI CTAG 2 cut(s) 177, 261
StyD4I CCNGG 1 cut(s) 264
TasI AATT 3 cut(s) 94, 126, 159
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TscAI CASTG 1 cut(s) 121
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 107
TspRI CASTG 1 cut(s) 121
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 2 cut(s) 94, 159
XceI RCATGY 1 cut(s) 53
XspI CTAG 2 cut(s) 177, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.