RchiOBHm_Chr4g0394031

60S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
9708046 .. 9708651
606 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 336 bp
ATGAGACCGAACCGGCCTGAATTTTATTATGCTTTTGTTGATACCCCTGATATGGTGAGATCTCAAATGAATTTCCAGAGGCTTTCTCTCACTGACATCAAAATTGACATCAAGAGGGTCCCCAAAAAGAAGGAATTGCTTGCGGCAATGGAGGCTGCTGGTAGGCTCAGTAACTTGTTAATAAGGATGATTTTCTCTTGGGGTAGGAAGCTTATTGTTCAGAAGCGAAGGGCCAATCTTAATGACTTTGACCGCTTCAAGCTTATGTTGGCTAAGATCAAGAGGGCTGGCCTGGTCAAGAGCGAACTTGCAAAACTAAAGAGGCAGAGTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L14e

Protein Analysis

111

Amino Acids

13.05

Weight (kDa)

11.03

Isoelectric Point (pI)

37.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L14e PF01929 20 - 95 4.1e-17 Ribosomal protein L14
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 143, 253
AcsI RAATTY 2 cut(s) 20, 70
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 1 cut(s) 291
AluBI AGCT 2 cut(s) 211, 262
AluI AGCT 2 cut(s) 211, 262
AoxI GGCC 3 cut(s) 14, 231, 289
ApeKI GCWGC 1 cut(s) 155
ApoI RAATTY 2 cut(s) 20, 70
AspS9I GGNCC 2 cut(s) 118, 231
AsuHPI GGTGA 1 cut(s) 67
AvaII GGWCC 1 cut(s) 118
BbvI GCAGC 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 293
BglII AGATCT 1 cut(s) 59
BisI GCNGC 2 cut(s) 144, 156
BlsI GCNGC 2 cut(s) 145, 157
Bme1390I CCNGG 1 cut(s) 293
Bme18I GGWCC 1 cut(s) 118
BmgT120I GGNCC 2 cut(s) 118, 231
BmiI GGNNCC 2 cut(s) 119, 120
BmrFI CCNGG 1 cut(s) 293
BplI GAGNNNNNCTC 2 cut(s) 70, 102
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse118I RCCGGY 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 153
BseBI CCWGG 1 cut(s) 293
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 142
BshFI GGCC 3 cut(s) 16, 233, 291
BsiSI CCGG 1 cut(s) 13
BslFI GGGAC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 104
BsnI GGCC 3 cut(s) 16, 233, 291
Bsp143I GATC 2 cut(s) 59, 276
BspACI CCGC 2 cut(s) 143, 253
BspANI GGCC 3 cut(s) 16, 233, 291
BspCNI CTCAG 1 cut(s) 180
BspLI GGNNCC 2 cut(s) 119, 120
BsrDI GCAATG 1 cut(s) 153
BsrFI RCCGGY 1 cut(s) 12
BssAI RCCGGY 1 cut(s) 12
BssMI GATC 2 cut(s) 59, 276
Bst2UI CCWGG 1 cut(s) 293
BstC8I GCNNGC 2 cut(s) 141, 289
BstDEI CTNAG 3 cut(s) 167, 273, 333
BstF5I GGATG 1 cut(s) 192
BstKTI GATC 2 cut(s) 62, 279
BstMBI GATC 2 cut(s) 59, 276
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 293
BstSCI CCNGG 1 cut(s) 291
BstV1I GCAGC 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BsuRI GGCC 3 cut(s) 16, 233, 291
BtsCI GGATG 1 cut(s) 192
BtsIMutI CAGTG 1 cut(s) 90
Cac8I GCNNGC 2 cut(s) 141, 289
Cfr10I RCCGGY 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 118, 231
DdeI CTNAG 3 cut(s) 167, 273, 333
DpnI GATC 2 cut(s) 61, 278
DpnII GATC 2 cut(s) 59, 276
Eco47I GGWCC 1 cut(s) 118
EcoO109I RGGNCCY 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 291
FaiI YATR 3 cut(s) 30, 53, 266
FaqI GGGAC 1 cut(s) 104
Fnu4HI GCNGC 2 cut(s) 144, 156
FokI GGATG 1 cut(s) 199
Fsp4HI GCNGC 2 cut(s) 144, 156
GluI GCNGC 2 cut(s) 144, 156
HaeIII GGCC 3 cut(s) 16, 233, 291
HapII CCGG 1 cut(s) 13
HindIII AAGCTT 2 cut(s) 209, 260
HpaII CCGG 1 cut(s) 13
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 4 cut(s) 76, 112, 280, 298
HpyAV CCTTC 2 cut(s) 124, 222
HpyCH4V TGCA 1 cut(s) 311
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 3 cut(s) 167, 273, 333
KflI GGGWCCC 1 cut(s) 118
Kzo9I GATC 2 cut(s) 59, 276
LpnPI CCDG 8 cut(s) 26, 30, 60, 89, 144, 273, 278, 305
Lsp1109I GCAGC 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 170
MalI GATC 2 cut(s) 61, 278
MboI GATC 2 cut(s) 59, 276
MflI RGATCY 1 cut(s) 59
MluCI AATT 4 cut(s) 20, 70, 102, 134
MnlI CCTC 5 cut(s) 72, 108, 145, 276, 315
MseI TTAA 2 cut(s) 179, 240
MspI CCGG 1 cut(s) 13
MspR9I CCNGG 1 cut(s) 293
MvaI CCWGG 1 cut(s) 293
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 2 cut(s) 59, 276
NlaIV GGNNCC 2 cut(s) 119, 120
PkrI GCNGC 2 cut(s) 145, 157
PpuMI RGGWCCY 1 cut(s) 118
Psp5II RGGWCCY 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 291
PspGI CCWGG 1 cut(s) 291
PspN4I GGNNCC 2 cut(s) 119, 120
PspPI GGNCC 2 cut(s) 118, 231
PspPPI RGGWCCY 1 cut(s) 118
PsuI RGATCY 1 cut(s) 59
SaqAI TTAA 2 cut(s) 179, 240
SatI GCNGC 2 cut(s) 144, 156
Sau3AI GATC 2 cut(s) 59, 276
Sau96I GGNCC 2 cut(s) 118, 231
ScrFI CCNGG 1 cut(s) 293
SetI ASST 2 cut(s) 213, 264
SinI GGWCC 1 cut(s) 118
Sse9I AATT 4 cut(s) 20, 70, 102, 134
SsiI CCGC 2 cut(s) 143, 253
StyD4I CCNGG 1 cut(s) 291
TaqII GACCGA 1 cut(s) 22
TasI AATT 4 cut(s) 20, 70, 102, 134
TauI GCSGC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 179, 240
Tru9I TTAA 2 cut(s) 179, 240
TscAI CASTG 1 cut(s) 97
TseI GCWGC 1 cut(s) 155
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 118
XapI RAATTY 2 cut(s) 20, 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.