RchiOBHm_Chr4g0398471

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
14977218 .. 14977767
550 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGCAGAAAATCCAACTCCAAGCTCAGAAGTCTCCAAATCACTCTGAATTTGTAGCCCACAACTACACTTCCAGCCTCTTCCCCTATTTCGAACACTGGCGAAAAGAATACATGTTTGGAAAAGATGACAGAAGCCAATTAAGTAAGCCAGGACAAGCTCGATCTCGGCGGAGACGGAGATTAAGCTTCTGA

Protein Analysis

63

Amino Acids

7.69

Weight (kDa)

10.69

Isoelectric Point (pI)

87.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AcsI RAATTY 1 cut(s) 47
AflIII ACRYGT 1 cut(s) 111
AjnI CCWGG 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 99, 131
AluBI AGCT 3 cut(s) 23, 158, 186
AluI AGCT 3 cut(s) 23, 158, 186
Alw26I GTCTC 2 cut(s) 36, 166
ApoI RAATTY 1 cut(s) 47
AsuII TTCGAA 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 150
BcoDI GTCTC 2 cut(s) 36, 166
Bme1390I CCNGG 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 150
Bpu14I TTCGAA 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 101
BseBI CCWGG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 38
BseNI ACTGG 1 cut(s) 101
BsmAI GTCTC 2 cut(s) 36, 166
BsmBI CGTCTC 1 cut(s) 166
Bsp119I TTCGAA 1 cut(s) 90
Bsp143I GATC 1 cut(s) 161
BspACI CCGC 1 cut(s) 169
BspCNI CTCAG 1 cut(s) 37
BspT104I TTCGAA 1 cut(s) 90
BsrI ACTGG 1 cut(s) 101
BssMI GATC 1 cut(s) 161
Bst2UI CCWGG 1 cut(s) 150
Bst6I CTCTTC 1 cut(s) 83
BstBI TTCGAA 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 1 cut(s) 164
BstMAI GTCTC 2 cut(s) 36, 166
BstMBI GATC 1 cut(s) 161
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 148
BtsIMutI CAGTG 1 cut(s) 94
CviAII CATG 1 cut(s) 112
CviJI RGCY 7 cut(s) 23, 56, 75, 135, 148, 158, 186
CviKI_1 RGCY 7 cut(s) 23, 56, 75, 135, 148, 158, 186
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 163
DpnII GATC 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
EciI GGCGGA 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 148
Esp3I CGTCTC 1 cut(s) 166
FaeI CATG 1 cut(s) 115
FaiI YATR 1 cut(s) 113
FatI CATG 1 cut(s) 111
Hin1II CATG 1 cut(s) 115
HindIII AAGCTT 1 cut(s) 184
Hpy188I TCNGA 3 cut(s) 27, 46, 191
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 1 cut(s) 115
Kzo9I GATC 1 cut(s) 161
LpnPI CCDG 4 cut(s) 82, 85, 135, 162
MalI GATC 1 cut(s) 163
MboI GATC 1 cut(s) 161
MboII GAAGA 1 cut(s) 70
MluCI AATT 2 cut(s) 47, 137
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 86
MseI TTAA 2 cut(s) 140, 182
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
NdeII GATC 1 cut(s) 161
NlaIII CATG 1 cut(s) 115
NmeAIII GCCGAG 1 cut(s) 145
NspI RCATGY 1 cut(s) 115
NspV TTCGAA 1 cut(s) 90
PciI ACATGT 1 cut(s) 111
PscI ACATGT 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
SaqAI TTAA 2 cut(s) 140, 182
Sau3AI GATC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 150
SetI ASST 3 cut(s) 25, 160, 188
SfuI TTCGAA 1 cut(s) 90
SgeI CNNG 9 cut(s) 32, 84, 109, 124, 161, 162, 167, 171, 177
Sse9I AATT 2 cut(s) 47, 137
SsiI CCGC 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 148
TaqI TCGA 2 cut(s) 90, 160
TasI AATT 2 cut(s) 47, 137
Tru1I TTAA 2 cut(s) 140, 182
Tru9I TTAA 2 cut(s) 140, 182
TscAI CASTG 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 190
TspRI CASTG 1 cut(s) 101
XapI RAATTY 1 cut(s) 47
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.