RchiOBHm_Chr4g0399371

AP-5 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
16590858 .. 16591111
254 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGCGGACAGAGACAACCGCGAGTGGGATTTCTATCTTAGAACCTTATCAAACAGCGCCAGAGACTCCAATGCCGCCAACAATCTCGCTTTTGATCCCACTCTTCTCCAATCCGTGAGTCCTCTTTCATCACTCTCTCTCTCTCTCTGCATTTCTCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.93

Weight (kDa)

4.85

Isoelectric Point (pI)

50.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 21
AciI CCGC 3 cut(s) 5, 19, 75
AclWI GGATC 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 25
Alw26I GTCTC 2 cut(s) 6, 57
AlwI GGATC 1 cut(s) 89
AspLEI GCGC 1 cut(s) 59
BcoDI GTCTC 2 cut(s) 6, 57
BfoI RGCGCY 1 cut(s) 60
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
BsaBI GATNNNNATC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse8I GATNNNNATC 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 25
Bsh1236I CGCG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 2 cut(s) 6, 57
Bsp143I GATC 1 cut(s) 94
BspACI CCGC 3 cut(s) 5, 19, 75
BspFNI CGCG 1 cut(s) 21
BspPI GGATC 1 cut(s) 89
BssMI GATC 1 cut(s) 94
Bst6I CTCTTC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 38
BstFNI CGCG 1 cut(s) 21
BstH2I RGCGCY 1 cut(s) 60
BstHHI GCGC 1 cut(s) 59
BstKTI GATC 1 cut(s) 97
BstMAI GTCTC 2 cut(s) 6, 57
BstMBI GATC 1 cut(s) 94
BstUI CGCG 1 cut(s) 21
CfoI GCGC 1 cut(s) 59
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
EciI GGCGGA 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 75
Fsp4HI GCNGC 1 cut(s) 75
GlaI GCGC 1 cut(s) 58
GluI GCNGC 1 cut(s) 75
HaeII RGCGCY 1 cut(s) 60
HhaI GCGC 1 cut(s) 59
Hin6I GCGC 1 cut(s) 57
HinP1I GCGC 1 cut(s) 57
HinfI GANTC 2 cut(s) 65, 118
HpyCH4V TGCA 1 cut(s) 150
HpyF3I CTNAG 1 cut(s) 38
HspAI GCGC 1 cut(s) 57
Kzo9I GATC 1 cut(s) 94
LpnPI CCDG 1 cut(s) 73
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 1 cut(s) 95
MlyI GAGTC 2 cut(s) 59, 127
MnlI CCTC 1 cut(s) 132
MvnI CGCG 1 cut(s) 21
NdeII GATC 1 cut(s) 94
PkrI GCNGC 1 cut(s) 76
PleI GAGTC 2 cut(s) 59, 126
PpsI GAGTC 2 cut(s) 59, 126
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 94
SchI GAGTC 2 cut(s) 59, 127
SetI ASST 1 cut(s) 47
SgeI CNNG 5 cut(s) 32, 34, 72, 98, 127
SsiI CCGC 3 cut(s) 5, 19, 75
TauI GCSGC 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 117
TspGWI ACGGA 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.