RchiOBHm_Chr4g0403531

Lipase 3 N-terminal region

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
22823809 .. 22824732
924 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGCTTTCCTGGATACATTTGATTGTGATCATTATGTTGAACCAGGATGACTTCTTACCACGGAAGGCCACACCCTTGGAAGACATTTTCAAGTCATTTTTCTGGTATGATTATGTCTTATCCTCTGTCTTCAACTGTTTCTTTGAGCTGATGGATAGTAAAGATAATACAAGAGTGCAGAACAAGATAGAAATTAAAATGCCCTTTACAATATCATTTTGTGTTGCTAATATATATCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.63

Weight (kDa)

5.47

Isoelectric Point (pI)

46.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 40, 91, 133
AjnI CCWGG 2 cut(s) 8, 42
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AoxI GGCC 1 cut(s) 66
BbsI GAAGAC 2 cut(s) 87, 121
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 2 cut(s) 10, 44
BciVI GTATCC 1 cut(s) 6
BclI TGATCA 1 cut(s) 27
BfaI CTAG 1 cut(s) 241
BfuI GTATCC 1 cut(s) 6
Bme1390I CCNGG 2 cut(s) 10, 44
BmrFI CCNGG 2 cut(s) 10, 44
BpiI GAAGAC 2 cut(s) 87, 121
BsaBI GATNNNNATC 1 cut(s) 26
BsaJI CCNNGG 2 cut(s) 59, 75
Bse8I GATNNNNATC 1 cut(s) 26
BseBI CCWGG 2 cut(s) 10, 44
BseDI CCNNGG 2 cut(s) 59, 75
BseGI GGATG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 197
BshFI GGCC 1 cut(s) 68
BsnI GGCC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 27
BspANI GGCC 1 cut(s) 68
BssECI CCNNGG 2 cut(s) 59, 75
BssMI GATC 1 cut(s) 27
BssT1I CCWWGG 1 cut(s) 75
Bst2UI CCWGG 2 cut(s) 10, 44
Bst4CI ACNGT 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 59
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstNI CCWGG 2 cut(s) 10, 44
BstSCI CCNGG 2 cut(s) 8, 42
BstV2I GAAGAC 2 cut(s) 87, 121
BstXI CCANNNNNNTGG 1 cut(s) 76
BsuI GTATCC 1 cut(s) 6
BsuRI GGCC 1 cut(s) 68
BtgI CCRYGG 1 cut(s) 59
BtsCI GGATG 1 cut(s) 52
CviJI RGCY 2 cut(s) 68, 148
CviKI_1 RGCY 2 cut(s) 68, 148
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 75
EcoRII CCWGG 2 cut(s) 8, 42
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
FaiI YATR 5 cut(s) 35, 108, 114, 233, 235
FbaI TGATCA 1 cut(s) 27
FokI GGATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 241
HaeIII GGCC 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 178
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 4 cut(s) 22, 29, 56, 88
MaeI CTAG 1 cut(s) 241
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 2 cut(s) 92, 121
MluCI AATT 1 cut(s) 192
MnlI CCTC 1 cut(s) 133
MseI TTAA 1 cut(s) 195
MspR9I CCNGG 2 cut(s) 10, 44
MvaI CCWGG 2 cut(s) 10, 44
NdeII GATC 1 cut(s) 27
PfoI TCCNGGA 1 cut(s) 8
Psp6I CCWGG 2 cut(s) 8, 42
PspGI CCWGG 2 cut(s) 8, 42
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 1 cut(s) 27
ScrFI CCNGG 2 cut(s) 10, 44
SetI ASST 1 cut(s) 150
Sse9I AATT 1 cut(s) 192
SspMI CTAG 1 cut(s) 241
StyD4I CCNGG 2 cut(s) 8, 42
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 137
TasI AATT 1 cut(s) 192
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspGWI ACGGA 1 cut(s) 76
XspI CTAG 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.