RchiOBHm_Chr4g0404061

Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
23565242 .. 23567805
2564 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 444 bp
ATGGAGTTCAAGGGTTCACGACAGCAACAAATTGGCACAACCCTTTGGTTTTCTTTTTCAACTCTTGTTTTTGCACACAAGGAGAGGGTGGTGAGCAATTGGACAAGATTTGAGCTAATCATATGGATTTTTCTAGTACTCATCCTAACACAGAGTTACACTGCAACCTTAGCATCACTACTGATTGTAGAAAGACGTAATGGTGATTATGTTGGATACCAAAAGAATTCCTTTGTACGAGAGCTTTTGATAAGAGAATTGAAGTTTGAGGAGAACAGGCTAAAGTACTATAGATTTCTGGAGGATTATCATAAAGCATTGTCTCAAGGAAGCAAAAATGGTGGTGTTGATGCTATCTTTGGCGAAATCCCCTACTTGAAGCTCTTACTGGCCAAGTATTGTGCTGGATACACTGTTGTTGGACTTTCAACCTCTTTCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

17.13

Weight (kDa)

9.35

Isoelectric Point (pI)

21.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lig_chan PF00060 6 - 67 2.8e-17 Ligand-gated ion channel
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 390
AcsI RAATTY 1 cut(s) 226
AfaI GTAC 3 cut(s) 138, 237, 287
AgsI TTSAA 6 cut(s) 10, 60, 262, 379, 429, 439
AluBI AGCT 3 cut(s) 115, 244, 382
AluI AGCT 3 cut(s) 115, 244, 382
Alw26I GTCTC 1 cut(s) 327
AoxI GGCC 1 cut(s) 390
ApoI RAATTY 1 cut(s) 226
AsuHPI GGTGA 2 cut(s) 103, 215
BalI TGGCCA 1 cut(s) 392
BciVI GTATCC 2 cut(s) 209, 401
BcoDI GTCTC 1 cut(s) 327
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 289
BfuI GTATCC 2 cut(s) 209, 401
BmcAI AGTACT 2 cut(s) 138, 287
BmsI GCATC 2 cut(s) 182, 340
BpmI CTGGAG 1 cut(s) 320
Bpu10I CCTNAGC 1 cut(s) 169
BpuEI CTTGAG 1 cut(s) 309
Bse1I ACTGG 1 cut(s) 393
BseGI GGATG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 393
BseRI GAGGAG 1 cut(s) 284
BshFI GGCC 1 cut(s) 392
BsmAI GTCTC 1 cut(s) 327
BsnI GGCC 1 cut(s) 392
BspANI GGCC 1 cut(s) 392
BsrI ACTGG 1 cut(s) 393
Bst4CI ACNGT 1 cut(s) 415
BstDEI CTNAG 1 cut(s) 169
BstF5I GGATG 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 327
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstSFI CTRYAG 1 cut(s) 289
BsuI GTATCC 2 cut(s) 209, 401
BsuRI GGCC 1 cut(s) 392
BtsCI GGATG 1 cut(s) 141
BtsI GCAGTG 1 cut(s) 159
BtsIMutI CAGTG 2 cut(s) 159, 411
Csp6I GTAC 3 cut(s) 137, 236, 286
CspCI CAANNNNNGTGG 2 cut(s) 322, 357
CviJI RGCY 5 cut(s) 115, 244, 280, 382, 392
CviKI_1 RGCY 5 cut(s) 115, 244, 280, 382, 392
CviQI GTAC 3 cut(s) 137, 236, 286
DdeI CTNAG 1 cut(s) 169
EaeI YGGCCR 1 cut(s) 390
EcoRI GAATTC 1 cut(s) 226
FaiI YATR 5 cut(s) 122, 124, 210, 291, 312
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FauNDI CATATG 1 cut(s) 122
FokI GGATG 1 cut(s) 128
FspBI CTAG 1 cut(s) 134
GsuI CTGGAG 1 cut(s) 320
HaeIII GGCC 1 cut(s) 392
HphI GGTGA 2 cut(s) 103, 215
Hpy166II GTNNAC 1 cut(s) 17
Hpy188III TCNNGA 2 cut(s) 18, 299
Hpy8I GTNNAC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 415
HpyCH4IV ACGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 74, 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 169
HpySE526I ACGT 1 cut(s) 196
LpnPI CCDG 4 cut(s) 262, 284, 374, 390
LweI GCATC 2 cut(s) 182, 340
MaeI CTAG 1 cut(s) 134
MaeII ACGT 1 cut(s) 196
MaeIII GTNAC 1 cut(s) 155
MfeI CAATTG 2 cut(s) 97, 439
MlsI TGGCCA 1 cut(s) 392
MluCI AATT 5 cut(s) 30, 97, 226, 257, 439
MluNI TGGCCA 1 cut(s) 392
MmeI TCCRAC 2 cut(s) 193, 400
MnlI CCTC 4 cut(s) 78, 262, 295, 442
Mox20I TGGCCA 1 cut(s) 392
MscI TGGCCA 1 cut(s) 392
Msp20I TGGCCA 1 cut(s) 392
MunI CAATTG 2 cut(s) 97, 439
MwoI GCNNNNNNNGC 1 cut(s) 170
NdeI CATATG 1 cut(s) 122
RsaI GTAC 3 cut(s) 138, 237, 287
RsaNI GTAC 3 cut(s) 137, 236, 286
ScaI AGTACT 2 cut(s) 138, 287
SetI ASST 6 cut(s) 117, 170, 199, 246, 384, 434
SfaNI GCATC 2 cut(s) 182, 340
SfcI CTRYAG 1 cut(s) 289
SmlI CTYRAG 1 cut(s) 324
SmoI CTYRAG 1 cut(s) 324
Sse9I AATT 5 cut(s) 30, 97, 226, 257, 439
SspMI CTAG 1 cut(s) 134
TaaI ACNGT 1 cut(s) 415
TaiI ACGT 1 cut(s) 199
TasI AATT 5 cut(s) 30, 97, 226, 257, 439
TatI WGTACW 2 cut(s) 136, 285
TscAI CASTG 2 cut(s) 166, 418
TspRI CASTG 2 cut(s) 166, 418
XapI RAATTY 1 cut(s) 226
XspI CTAG 1 cut(s) 134
ZrmI AGTACT 2 cut(s) 138, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.