RchiOBHm_Chr4g0405851

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
26659301 .. 26659774
474 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGGAGATTGATTCCCAATCTTCGGAGATAGAAAGGCTTTTTGAGGAAAACTCTAATTTATCTAGTTCTCATCAGGAGGCTATGAGCATAGCTTTGCATTGGGAGAATCAGGAACTTTACTATTGCCTATCTGTGCATCTATCAATTAACTATTTTACTTATCAATTAACTATTTTACTTTTATTTTTTTGTAGTATTCTTGGACGGTTTAGTTTCCCATTAACTAGGCTGAAAAAATTGTCAGTTGTGCATGAAAATGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.19

Weight (kDa)

5.17

Isoelectric Point (pI)

56.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 22
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
BfaI CTAG 2 cut(s) 63, 225
BmsI GCATC 1 cut(s) 145
BplI GAGNNNNNCTC 2 cut(s) 35, 67
Bsc4I CCNNNNNNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 207
CviAII CATG 1 cut(s) 251
CviJI RGCY 4 cut(s) 37, 80, 92, 229
CviKI_1 RGCY 4 cut(s) 37, 80, 92, 229
FaeI CATG 1 cut(s) 254
FaiI YATR 3 cut(s) 83, 89, 252
FatI CATG 1 cut(s) 250
FspBI CTAG 2 cut(s) 63, 225
Hin1II CATG 1 cut(s) 254
HinfI GANTC 2 cut(s) 11, 106
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 2 cut(s) 74, 110
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4V TGCA 3 cut(s) 97, 136, 250
Hsp92II CATG 1 cut(s) 254
LpnPI CCDG 2 cut(s) 59, 95
LweI GCATC 1 cut(s) 145
MaeI CTAG 2 cut(s) 63, 225
MboII GAAGA 1 cut(s) 12
MluCI AATT 4 cut(s) 55, 144, 164, 236
MnlI CCTC 2 cut(s) 37, 70
MseI TTAA 3 cut(s) 147, 167, 221
MslI CAYNNNNRTG 1 cut(s) 255
NlaIII CATG 1 cut(s) 254
PfeI GAWTC 2 cut(s) 11, 106
RseI CAYNNNNRTG 1 cut(s) 255
SaqAI TTAA 3 cut(s) 147, 167, 221
SetI ASST 1 cut(s) 94
SfaNI GCATC 1 cut(s) 145
SgeI CNNG 5 cut(s) 75, 86, 122, 212, 237
SmiMI CAYNNNNRTG 1 cut(s) 255
Sse9I AATT 4 cut(s) 55, 144, 164, 236
SspMI CTAG 2 cut(s) 63, 225
TaaI ACNGT 1 cut(s) 207
TasI AATT 4 cut(s) 55, 144, 164, 236
TfiI GAWTC 2 cut(s) 11, 106
Tru1I TTAA 3 cut(s) 147, 167, 221
Tru9I TTAA 3 cut(s) 147, 167, 221
XspI CTAG 2 cut(s) 63, 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.