RchiOBHm_Chr4g0406991

Heavy metal-associated isoprenylated plant protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
29054566 .. 29054739
174 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGGACTACGAAGGTTGCGAGAGAAGAGTGAAGAAATCAATGGAAGGCATGAAAGGAATCACAAGTGTTGAAATGGATCCCAAGCAAAGCAAGCTCACTGTTATTGGCTATGTGGACCCCAACAAGGTGTTGCATCGTGTCAGGCATCAAAGGGGGAAGAAGGCGGATCTGTGA

Protein Analysis

57

Amino Acids

6.57

Weight (kDa)

9.66

Isoelectric Point (pI)

22.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 4 - 48 4e-09 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 164
AclWI GGATC 2 cut(s) 71, 84
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AlwI GGATC 2 cut(s) 71, 84
AspS9I GGNCC 1 cut(s) 115
AvaII GGWCC 1 cut(s) 115
BamHI GGATCC 1 cut(s) 76
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 2 cut(s) 78, 117
BmsI GCATC 2 cut(s) 142, 154
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 124
BslI CCNNNNNNNGG 1 cut(s) 124
Bsp143I GATC 2 cut(s) 76, 166
BspACI CCGC 1 cut(s) 164
BspLI GGNNCC 2 cut(s) 78, 117
BspPI GGATC 2 cut(s) 71, 84
BssMI GATC 2 cut(s) 76, 166
Bst4CI ACNGT 1 cut(s) 100
Bst6I CTCTTC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 92
BstKTI GATC 2 cut(s) 79, 169
BstMBI GATC 2 cut(s) 76, 166
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstX2I RGATCY 2 cut(s) 76, 166
BstYI RGATCY 2 cut(s) 76, 166
BtsIMutI CAGTG 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 115
CviAII CATG 1 cut(s) 49
CviJI RGCY 2 cut(s) 94, 108
CviKI_1 RGCY 2 cut(s) 94, 108
DpnI GATC 2 cut(s) 78, 168
DpnII GATC 2 cut(s) 76, 166
Eam1104I CTCTTC 1 cut(s) 19
EarI CTCTTC 1 cut(s) 19
Eco47I GGWCC 1 cut(s) 115
FaeI CATG 1 cut(s) 52
FaiI YATR 2 cut(s) 50, 111
FatI CATG 1 cut(s) 48
Hin1II CATG 1 cut(s) 52
HinfI GANTC 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 115
Hpy8I GTNNAC 1 cut(s) 115
HpyAV CCTTC 3 cut(s) 5, 38, 154
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 2 cut(s) 76, 166
LpnPI CCDG 1 cut(s) 127
LweI GCATC 2 cut(s) 142, 154
MalI GATC 2 cut(s) 78, 168
MboI GATC 2 cut(s) 76, 166
MboII GAAGA 3 cut(s) 36, 43, 169
MflI RGATCY 2 cut(s) 76, 166
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 2 cut(s) 76, 166
NlaIII CATG 1 cut(s) 52
NlaIV GGNNCC 2 cut(s) 78, 117
PcsI WCGNNNNNNNCGW 1 cut(s) 15
PfeI GAWTC 1 cut(s) 57
PspN4I GGNNCC 2 cut(s) 78, 117
PspPI GGNCC 1 cut(s) 115
PsuI RGATCY 2 cut(s) 76, 166
Sau3AI GATC 2 cut(s) 76, 166
Sau96I GGNCC 1 cut(s) 115
SetI ASST 3 cut(s) 16, 96, 129
SfaNI GCATC 2 cut(s) 142, 154
SgeI CNNG 8 cut(s) 31, 61, 75, 94, 103, 136, 149, 154
SinI GGWCC 1 cut(s) 115
SsiI CCGC 1 cut(s) 164
TaaI ACNGT 1 cut(s) 100
TfiI GAWTC 1 cut(s) 57
TscAI CASTG 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 65
TspRI CASTG 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.